<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30976?offset=530</link>
	<atom:link href="https://bioinformaticsonline.com/related/30976?offset=530" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</guid>
	<pubDate>Tue, 12 Dec 2017 17:30:12 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</link>
	<title><![CDATA[Mash: fast genome and metagenome distance estimation using MinHash]]></title>
	<description><![CDATA[<p>Mash is normally distributed as a dependency-free binary for Linux or OSX (see&nbsp;<a href="https://github.com/marbl/Mash/releases">https://github.com/marbl/Mash/releases</a>). This source distribution is intended for other operating systems or for development. Mash requires c++11 to build, which is available in and GCC &gt;= 4.8 and OSX &gt;= 10.7.</p>
<p>See&nbsp;<a href="http://mash.readthedocs.org/">http://mash.readthedocs.org</a>&nbsp;for more information.</p><p>Address of the bookmark: <a href="https://github.com/marbl/Mash/releases" rel="nofollow">https://github.com/marbl/Mash/releases</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23924/embl-postdoc-position-in-bacterial-gene-gain-loss</guid>
  <pubDate>Thu, 20 Aug 2015 14:09:21 -0500</pubDate>
  <link></link>
  <title><![CDATA[EMBL Postdoc position in Bacterial Gene Gain Loss]]></title>
  <description><![CDATA[
<p>A post-doctoral fellowship is available in the research groups of Nick Goldman (EBI) and John Welch (Genetics Department, Cambridge University) under the EMBL-EBI / Cambridge Computational Biomedical Postdoctoral Fellowship scheme.</p>

<p>The project is on bacterial gene gain and loss and emerging pathogenicity, and is described in full here: https://www.ebi.ac.uk/research/postdocs/ebpods/projects/goldman-welch-2015 . The EMBL-EBI / Cambridge Computational Biomedical Postdoctoral (“EBPOD”) </p>

<p>The closing date for applications is 3 September 2015. Nick Goldman EMBL-European Bioinformatics Institute Nick Goldman </p>

<p>More at https://www.ebi.ac.uk/research/postdocs/ebpods/projects/goldman-welch-2015</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5254/mike-ritchie-lab</guid>
  <pubDate>Wed, 02 Oct 2013 15:25:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[Mike Ritchie Lab]]></title>
  <description><![CDATA[
<p>Mike Ritchie Lab primary research focus is the detection of susceptibility genes for common diseases such as cancer, diabetes, hypertension, and cardiovascular disease, among others. The approaches will involve the development and application of new statistical methods with a focus on the detection of gene-gene interactions associated with human disease.</p>

<p>Gene expression and protein expression patterns between normal and non-normal tissues is a growing area of research that may lead to the identification of candidate genes for understanding the etiology of common, complex diseases. </p>

<p>Lab homepage @ http://ritchielab.psu.edu/ritchielab/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5403/research-associate-icgeb-new-delhi</guid>
  <pubDate>Wed, 09 Oct 2013 13:49:20 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate @ ICGEB, New Delhi.]]></title>
  <description><![CDATA[
<p>Applications are invited for Research Associate position in the DBT Sponsored Bioinformatics Infrastructure Facility at ICGEB, New Delhi.</p>

<p>Essential requirements: Experience of using bioinformatics tools.</p>

<p>Experience of working in Linux. Basic knowledge of computer network administration.</p>

<p>Desirable: Knowledge of Linux installation/administration and proficiency in either of the following:</p>

<p>Shell/PERL/Java/Python/VB/Oracle/MySQL/C/CUDA.</p>

<p>Qualification: PhD. or First class M.Sc degree in Bioinformatics or Biotechnology/life science with specialization in Bioinformatics.</p>

<p>Fellowships: Rs 22,000/- with HRA for PhD qualified, Rs 16000/- with HRA for NET/BET/BINC/GATE qualified and 12000/- with HRA for non NET qualified applicants.</p>

<p>Interested candidates may send their complete biodata along with a write-up of their experience and suitability for the position to Dr. Dinesh Gupta by email only to dinesh@icgeb.res.in within 15 days of publication of this advertisement. Kindly mark the email with subject “Application for BIF-RA-2013”</p>

<p>Closing date for applications: 18 October 2013</p>

<p>Only short listed candidates will be invited for an interview at ICGEB.</p>

<p>No TA/DA will be paid for attending the interview.</p>

<p>Advertisement: http://www.icgeb.org/tl_files/Vacancies/BIF-RA-Advt.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5574/srfjrfra-university-of-hyderabad</guid>
  <pubDate>Mon, 14 Oct 2013 07:49:11 -0500</pubDate>
  <link></link>
  <title><![CDATA[SRF/JRF/RA @ UNIVERSITY OF HYDERABAD]]></title>
  <description><![CDATA[
<p>SCHOOL OF CHEMISTRY, UNIVERSITY OF HYDERABAD</p>

<p>Applications on plain paper along with details of CV (relevant photocopies of their<br />qualifications/experience and reprints of published work to be attached) are invited from qualified candidates for Research Fellowship in CSIR- sponsored research project.</p>

<p>JRF/SRF/RA (one vacancy)</p>

<p>CSIR sponsored “In silico design, identification and in vitro validation of lead molecule inhibitors to Bcr-Abl kinase”</p>

<p>JRF: M.Sc in Chemistry/ Bioinformatics/ Biotechnology with I division and NET or GATE qualified</p>

<p>SRF: M.Sc in chemistry/ Bioinformatics/ Biotechnology with at least two years of post- M.Sc research experience as evidenced from published papers in standard refereed journals in relevant area</p>

<p>RA: PhD in chemistry/ Bioinformatics/ Biotechnology with research experience in<br />relevant area.</p>

<p>As per CSIR guidelines</p>

<p>Notes:<br />1) You may visit the University of Hyderabad website www.uohyd.ernet.in to learn more about the University of Hyderabad.<br />2) Applicants should note that the appointment to be made is purely temporary and there is no right for claiming for any regular appointment in the University.<br />3) No TA/DA will be paid for attending the interview or at the time of joining the post, if selected.<br />4) The application should be submitted by post/courier/in-person to the address given below on or before November 1st 2013.</p>

<p>Prof. Lalitha Guruprasad<br />W-103, Gurbakhsh Singh Building<br />School of Chemistry<br />University of Hyderabad<br />Hyderabad- 500 046<br />5) Short-listed candidates will be called for interview at a short notice.</p>

<p>Advertisement: http://www.uohyd.ac.in/images/recruitment/chemisry_advt_101013.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5702/research-fellow-in-bioinformatics-queens-university-belfast-institute-for-global-food-security-school-of-biological-sciences</guid>
  <pubDate>Thu, 17 Oct 2013 04:33:02 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Fellow in Bioinformatics @  Queen's University Belfast -Institute for Global Food Security, School of Biological Sciences]]></title>
  <description><![CDATA[
<p>Ref: 13/102900</p>

<p>Available immediately until 30th November 2015, to work on the development of bioinformatics approaches to aid analysis of data derived from the metabolomic profiling of biological matrices. The successful applicant will lead research activities on an FP7 funded EU-wide collaborative project aimed at establishing biomarker-based strategies for high throughput diagnostic screening. Key tasks will involve multivariate analysis of large datasets, bioinformatic-based selection and validation of identified markers, construction of metabolomic spectral profile databases and development of machine learning/database searching approaches amenable to analytical screening techniques. This position will offer the opportunity to travel and undertake work with project collaborators based in the Republic of Ireland and Europe.</p>

<p>Informal enquiries may be directed to Dr Terry McGrath, email: terry.mcgrath@qub.ac.uk.</p>

<p>Anticipated interview date: Thursday 31st October 2013<br />Salary scale: £30,424 – £39,649 per annum (including contribution points)<br />Closing date: Monday 21st October 2013  </p>

<p>Telephone (028) 90973044 FAX: (028) 90971040 or e-mail on personnel@qub.ac.uk</p>

<p>The University is committed to equality of opportunity and to selection on merit.  It therefore welcomes applications from all sections of society and particularly welcomes applications from people with a disability. </p>

<p>Fixed term contract posts are available for the stated period in the first instance but in particular circumstances may be renewed or made permanent subject to availability of funding.</p>

<p>More @ https://hrwebapp.qub.ac.uk/tlive_webrecruitment/wrd/run/ETREC107GF.open?VACANCY_ID=5616943npO&amp;WVID=6273090Lgx&amp;LANG=USA</p>
]]></description>
</item>

</channel>
</rss>