<![CDATA[BOL: Related items]]> https://bioinformaticsonline.com/related/31012?offset=1010 https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics Sun, 24 May 2015 09:28:33 -0500 https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics <![CDATA[Perl One liner basics !!]]> Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

]]> Abhimanyu Singh https://bioinformaticsonline.com/bookmarks/view/32862/gam-ngs-genomic-assemblies-merger-for-next-generation-sequencing Fri, 19 May 2017 07:44:14 -0500 https://bioinformaticsonline.com/bookmarks/view/32862/gam-ngs-genomic-assemblies-merger-for-next-generation-sequencing <![CDATA[GAM-NGS: genomic assemblies merger for next generation sequencing]]> GAM-NGS is a tool able to merge two or more assemblies in order to improve contiguity and correctness. It can be used on all NGS-based assembly projects and it shows its full potential with multi-library Illumina-based projects. With more than 20 available assemblers it is hard to select the best tool. In this context we propose a tool that improves assemblies (and, as a by-product, perhaps even assemblers) by merging them and selecting the generating that is most likely to be correct.

Address of the bookmark: https://github.com/vice87/gam-ngs

]]> Jit https://bioinformaticsonline.com/bookmarks/view/33506/bedops-v2426-high-performance-genomic-feature-operations Mon, 12 Jun 2017 10:11:01 -0500 https://bioinformaticsonline.com/bookmarks/view/33506/bedops-v2426-high-performance-genomic-feature-operations <![CDATA[BEDOPS v2.4.26: high-performance genomic feature operations]]> BEDOPS v2.4.26 is a suite of tools to address common questions raised in genomic studies — mostly with regard to overlap and proximity relationships between data sets. It aims to be scalable and flexible, facilitating the efficient and accurate analysis and management of large-scale genomic data.

The overview section of the BEDOPS v2.4.26 documentation summarizes the toolkit, functionality and performance enhancements. The reference table offers documentation for all applications and scripts.

Address of the bookmark: https://github.com/bedops/bedops

]]> Jit https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab Wed, 27 May 2015 17:52:24 -0500 <![CDATA[Rosenberg lab]]> Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

]]> https://bioinformaticsonline.com/bookmarks/view/36758/pbalign-maps-pacbio-reads-to-reference-sequences-and-saves-alignments-to-a-bam-file Thu, 24 May 2018 10:06:52 -0500 https://bioinformaticsonline.com/bookmarks/view/36758/pbalign-maps-pacbio-reads-to-reference-sequences-and-saves-alignments-to-a-bam-file <![CDATA[pbalign: maps PacBio reads to reference sequences and saves alignments to a BAM file]]> Address of the bookmark: https://github.com/PacificBiosciences/pbalign

]]> Jit https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong Thu, 28 May 2015 19:33:19 -0500 <![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong]]> ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

]]> https://bioinformaticsonline.com/blog/view/37225/installing-trinity Tue, 03 Jul 2018 04:31:15 -0500 https://bioinformaticsonline.com/blog/view/37225/installing-trinity <![CDATA[Installing Trinity !]]> Download this https://github.com/trinityrnaseq/trinityrnaseq/releases/tag/Trinity-v2.6.6

➜ cd trinityrnaseq-Trinity-v2.6.6

➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ make
Using gnu compiler for Inchworm and Chrysalis
cd Inchworm && (test -e configure || autoreconf) \
&& sh ./configure --prefix=`pwd` && make install
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for g++... g++
checking whether the C++ compiler works... yes
checking for C++ compiler default output file name... a.out
checking for suffix of executables...
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... gcc3
checking for library containing cos... none required
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
Making install in src
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_entry.o -MD -MP -MF .deps/Fasta_entry.Tpo -c -o Fasta_entry.o Fasta_entry.cpp
mv -f .deps/Fasta_entry.Tpo .deps/Fasta_entry.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE_run.o -MD -MP -MF .deps/IRKE_run.Tpo -c -o IRKE_run.o IRKE_run.cpp
mv -f .deps/IRKE_run.Tpo .deps/IRKE_run.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT sequenceUtil.o -MD -MP -MF .deps/sequenceUtil.Tpo -c -o sequenceUtil.o sequenceUtil.cpp
mv -f .deps/sequenceUtil.Tpo .deps/sequenceUtil.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE.o -MD -MP -MF .deps/IRKE.Tpo -c -o IRKE.o IRKE.cpp
mv -f .deps/IRKE.Tpo .deps/IRKE.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT KmerCounter.o -MD -MP -MF .deps/KmerCounter.Tpo -c -o KmerCounter.o KmerCounter.cpp
mv -f .deps/KmerCounter.Tpo .deps/KmerCounter.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT string_util.o -MD -MP -MF .deps/string_util.Tpo -c -o string_util.o string_util.cpp
mv -f .deps/string_util.Tpo .deps/string_util.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_reader.o -MD -MP -MF .deps/Fasta_reader.Tpo -c -o Fasta_reader.o Fasta_reader.cpp
mv -f .deps/Fasta_reader.Tpo .deps/Fasta_reader.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT stacktrace.o -MD -MP -MF .deps/stacktrace.Tpo -c -o stacktrace.o stacktrace.cpp
mv -f .deps/stacktrace.Tpo .deps/stacktrace.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp
mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o inchworm Fasta_entry.o IRKE_run.o sequenceUtil.o IRKE.o KmerCounter.o string_util.o Fasta_reader.o stacktrace.o argProcessor.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT cigar_tweaker.o -MD -MP -MF .deps/cigar_tweaker.Tpo -c -o cigar_tweaker.o cigar_tweaker.cpp
mv -f .deps/cigar_tweaker.Tpo .deps/cigar_tweaker.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_entry.o -MD -MP -MF .deps/SAM_entry.Tpo -c -o SAM_entry.o SAM_entry.cpp
mv -f .deps/SAM_entry.Tpo .deps/SAM_entry.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_reader.o -MD -MP -MF .deps/SAM_reader.Tpo -c -o SAM_reader.o SAM_reader.cpp
mv -f .deps/SAM_reader.Tpo .deps/SAM_reader.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Cigar.o -MD -MP -MF .deps/Cigar.Tpo -c -o Cigar.o Cigar.cpp
mv -f .deps/Cigar.Tpo .deps/Cigar.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o cigar_tweaker cigar_tweaker.o SAM_entry.o sequenceUtil.o SAM_reader.o Cigar.o string_util.o stacktrace.o Fasta_reader.o Fasta_entry.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT pull_reads_with_kmers.o -MD -MP -MF .deps/pull_reads_with_kmers.Tpo -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp
mv -f .deps/pull_reads_with_kmers.Tpo .deps/pull_reads_with_kmers.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o pull_reads_with_kmers pull_reads_with_kmers.o Fasta_reader.o Fasta_entry.o sequenceUtil.o KmerCounter.o string_util.o stacktrace.o argProcessor.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT FastaToDeBruijn.o -MD -MP -MF .deps/FastaToDeBruijn.Tpo -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp
FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector >, int, bool, ArgProcessor)’:
FastaToDeBruijn.cpp:199:39: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (seq_region.size() < kmer_length) { continue; } // can be e
^
mv -f .deps/FastaToDeBruijn.Tpo .deps/FastaToDeBruijn.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT DeBruijnGraph.o -MD -MP -MF .deps/DeBruijnGraph.Tpo -c -o DeBruijnGraph.o DeBruijnGraph.cpp
mv -f .deps/DeBruijnGraph.Tpo .deps/DeBruijnGraph.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o FastaToDeBruijn FastaToDeBruijn.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o DeBruijnGraph.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT fastaToKmerCoverageStats.o -MD -MP -MF .deps/fastaToKmerCoverageStats.Tpo -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp
fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&, std::__cxx11::string&)’:
fastaToKmerCoverageStats.cpp:226:18: warning: unused variable ‘kmer_length’ [-Wunused-variable]
unsigned int kmer_length = kcounter.get_kmer_length();
^
mv -f .deps/fastaToKmerCoverageStats.Tpo .deps/fastaToKmerCoverageStats.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o fastaToKmerCoverageStats fastaToKmerCoverageStats.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o KmerCounter.o
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin"
/usr/bin/install -c inchworm cigar_tweaker pull_reads_with_kmers FastaToDeBruijn fastaToKmerCoverageStats '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin'
make[3]: Nothing to be done for 'install-data-am'.
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[3]: Nothing to be done for 'install-exec-am'.
make[3]: Nothing to be done for 'install-data-am'.
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
cd Chrysalis && make UNSUPPORTED=yes
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'
./MakeDepend.cc: In member function ‘bool makefile_builder::dependency::operator<(const makefile_builder::dependency&) const’:
./MakeDepend.cc:93:47: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
dependent_ == other.dependent_ &&
^
./MakeDepend.cc: In member function ‘bool makefile_builder::subdir_and_target::operator<(const makefile_builder::subdir_and_target&) const’:
./MakeDepend.cc:130:41: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
subdir_ == other.subdir_ &&
^
./MakeDepend.cc: In function ‘int main(int, char**)’:
./MakeDepend.cc:223:20: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
char * options = "Ad:g:u:fh";
^
./MakeDepend.cc: In member function ‘void makefile_builder::DumpDependencies(const string&)’:
./MakeDepend.cc:491:46: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
if ( ! this->FileIsSource( dependent ) && ! this->FileIsHeader( dependent
^
./MakeDepend.cc:493:44: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
this->FileIsHeader( dependent ) && this->FileIsSource( provider ) )
^
./MakeDepend.cc: In member function ‘bool makefile_builder::FileIsHeader(const string&) const’:
./MakeDepend.cc:1339:32: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
return ( filename.size() > 2 &&
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:04 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./aligns/KmerAlignCore.cc -o obj/aligns/KmerAlignCore.o
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:06 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/AACodons.cc -o obj/analysis/AACodons.o
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:09 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/BreakTransByPairs.cc -o obj/analysis/BreakTransByPairs.o
./analysis/BreakTransByPairs.cc: In function ‘int main(int, char**)’:
./analysis/BreakTransByPairs.cc:105:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i > DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’:
./analysis/DeBruijnGraph.cc:473:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < left_extensions.size(); i++) {
^
./analysis/DeBruijnGraph.cc:476:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int j = 0; j < right_extensions.size(); j++) {
^
./analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&, std::vector >&, char, std::map&, int)’:
./analysis/DeBruijnGraph.cc:513:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < adjacent_kmers.size(); i++) {
^
./analysis/DeBruijnGraph.cc:527:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (kmer_extension_chars.size() == flank_extension_length) {
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:30 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/sequenceUtil.cc -o obj/analysis/sequenceUtil.o
./analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::__cxx11::string)’:
./analysis/sequenceUtil.cc:33:20: warning: array subscript has type ‘char’ [-Wchar-subscripts]
if (_base_to_int[c] > 3)
^
./analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::__cxx11::string)’:
./analysis/sequenceUtil.cc:264:26: warning: array subscript has type ‘char’ [-Wchar-subscripts]
int val = _base_to_int[c];
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:31 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/stacktrace.cc -o obj/analysis/stacktrace.o
/bin/rm -f lib_BubbleUpClustering_temp.a
ar -qc lib_BubbleUpClustering_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/BubbleUpClustering.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./BubbleUpClustering
g++ -ggdb3 -fopenmp -o ./BubbleUpClustering obj/analysis/BubbleUpClustering.o -L. -lm -pthread -l_BubbleUpClustering_temp
/bin/rm lib_BubbleUpClustering_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:32 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/Chrysalis.cc -o obj/analysis/Chrysalis.o
./analysis/Chrysalis.cc: In function ‘int main(int, char**)’:
./analysis/Chrysalis.cc:384:28: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(command.c_str());
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:35 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/TranscriptomeGraph.cc -o obj/analysis/TranscriptomeGraph.o
./analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&, FILE*, int, bool)’:
./analysis/TranscriptomeGraph.cc:668:20: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<=d.isize()-k; i++) {
^
/bin/rm -f lib_Chrysalis_temp.a
ar -qc lib_Chrysalis_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/Chrysalis.o obj/analysis/DNAVector.o obj/analysis/TranscriptomeGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./Chrysalis
g++ -ggdb3 -fopenmp -o ./Chrysalis obj/analysis/Chrysalis.o -L. -lm -pthread -l_Chrysalis_temp
/bin/rm lib_Chrysalis_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:39 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/CreateIwormFastaBundle.cc -o obj/analysis/CreateIwormFastaBundle.o
/bin/rm -f lib_CreateIwormFastaBundle_temp.a
ar -qc lib_CreateIwormFastaBundle_temp.a obj/analysis/AACodons.o obj/analysis/CreateIwormFastaBundle.o obj/analysis/DNAVector.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./CreateIwormFastaBundle
g++ -ggdb3 -fopenmp -o ./CreateIwormFastaBundle obj/analysis/CreateIwormFastaBundle.o -L. -lm -pthread -l_CreateIwormFastaBundle_temp
/bin/rm lib_CreateIwormFastaBundle_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:42 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/GraphFromFasta.cc -o obj/analysis/GraphFromFasta.o
./analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&)’:
./analysis/GraphFromFasta.cc:255:15: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
&&
^
./analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map<int, Pool>&, std::map&)’:
./analysis/GraphFromFasta.cc:631:31: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int j = 0; j < adjacent_nodes.size(); j++) {
^
./analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’:
./analysis/GraphFromFasta.cc:1164:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i bubble_up_cluster_growth(std::map&, std::map&)’:
./GraphFromFasta_MPI.cc:706:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc:727:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc:834:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc: In function ‘void add_unclustered_iworm_contigs(svec&, vecDNAVector&)’:
./GraphFromFasta_MPI.cc:1144:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t i = 0; i < p.size(); i++) {
^
./GraphFromFasta_MPI.cc: In function ‘int main(int, char**)’:
./GraphFromFasta_MPI.cc:1453:60: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) {
^
./GraphFromFasta_MPI.cc:1458:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.isize()-k; j++) {
^
./GraphFromFasta_MPI.cc:1479:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i)
^
./GraphFromFasta_MPI.cc:1503:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i)
^
./GraphFromFasta_MPI.cc:2235:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.isize()-k; j++) {
^
./GraphFromFasta_MPI.cc:2264:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i) {
^
./GraphFromFasta_MPI.cc:2359:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i) {
^
./GraphFromFasta_MPI.cc:2475:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<clustered_pools.isize(); i++) {
^
./GraphFromFasta_MPI.cc:2483:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t j = 0; j < p.size(); j++) {
^
./GraphFromFasta_MPI.cc:2496:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t j = 0; j < p.size(); j++) {
^
/bin/rm -f lib_GraphFromFasta_MPI_temp.a
ar -qc lib_GraphFromFasta_MPI_temp.a obj/GraphFromFasta_MPI.o obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./GraphFromFasta_MPI
g++ -ggdb3 -fopenmp -o ./GraphFromFasta_MPI obj/GraphFromFasta_MPI.o -L. -lm -pthread -l_GraphFromFasta_MPI_temp
/bin/rm lib_GraphFromFasta_MPI_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:53 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/IsoformAugment.cc -o obj/analysis/IsoformAugment.o
./analysis/IsoformAugment.cc: In function ‘int main(int, char**)’:
./analysis/IsoformAugment.cc:87:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<matchesLeft.isize(); j++) {
^
./analysis/IsoformAugment.cc:122:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<matches.isize(); j++) {
^
/bin/rm -f lib_IsoformAugment_temp.a
ar -qc lib_IsoformAugment_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/IsoformAugment.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./IsoformAugment
g++ -ggdb3 -fopenmp -o ./IsoformAugment obj/analysis/IsoformAugment.o -L. -lm -pthread -l_IsoformAugment_temp
/bin/rm lib_IsoformAugment_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:56 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/JoinTransByPairs.cc -o obj/analysis/JoinTransByPairs.o
./analysis/JoinTransByPairs.cc: In function ‘int main(int, char**)’:
./analysis/JoinTransByPairs.cc:293:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<dna.size(); i++) {
^
./analysis/JoinTransByPairs.cc:341:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<dna.size(); i++) {
^
/bin/rm -f lib_JoinTransByPairs_temp.a
ar -qc lib_JoinTransByPairs_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/JoinTransByPairs.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./JoinTransByPairs
g++ -ggdb3 -fopenmp -o ./JoinTransByPairs obj/analysis/JoinTransByPairs.o -L. -lm -pthread -l_JoinTransByPairs_temp
/bin/rm lib_JoinTransByPairs_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:00 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/QuantifyGraph.cc -o obj/analysis/QuantifyGraph.o
/bin/rm -f lib_QuantifyGraph_temp.a
ar -qc lib_QuantifyGraph_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/QuantifyGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./QuantifyGraph
g++ -ggdb3 -fopenmp -o ./QuantifyGraph obj/analysis/QuantifyGraph.o -L. -lm -pthread -l_QuantifyGraph_temp
/bin/rm lib_QuantifyGraph_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:03 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/ReadsToTranscripts.cc -o obj/analysis/ReadsToTranscripts.o
/bin/rm -f lib_ReadsToTranscripts_temp.a
ar -qc lib_ReadsToTranscripts_temp.a obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/analysis/ReadsToTranscripts.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts obj/analysis/ReadsToTranscripts.o -L. -lm -pthread -l_ReadsToTranscripts_temp
/bin/rm lib_ReadsToTranscripts_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:09 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./ReadsToTranscripts_MPI.cc -o obj/ReadsToTranscripts_MPI.o
/bin/rm -f lib_ReadsToTranscripts_MPI_temp.a
ar -qc lib_ReadsToTranscripts_MPI_temp.a obj/ReadsToTranscripts_MPI.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts_MPI
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts_MPI obj/ReadsToTranscripts_MPI.o -L. -lm -pthread -l_ReadsToTranscripts_MPI_temp
/bin/rm lib_ReadsToTranscripts_MPI_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:14 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./ReadsToTranscripts_MPI_chang.cc -o obj/ReadsToTranscripts_MPI_chang.o
/bin/rm -f lib_ReadsToTranscripts_MPI_chang_temp.a
ar -qc lib_ReadsToTranscripts_MPI_chang_temp.a obj/ReadsToTranscripts_MPI_chang.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts_MPI_chang
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts_MPI_chang obj/ReadsToTranscripts_MPI_chang.o -L. -lm -pthread -l_ReadsToTranscripts_MPI_chang_temp
/bin/rm lib_ReadsToTranscripts_MPI_chang_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:18 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/RunButterfly.cc -o obj/analysis/RunButterfly.o
./analysis/RunButterfly.cc: In member function ‘void JobControl::ClearFiles()’:
./analysis/RunButterfly.cc:107:25: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(rm.c_str());
^
./analysis/RunButterfly.cc: In member function ‘void JobControl::Submit()’:
./analysis/RunButterfly.cc:77:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(theCmmd.c_str());
^
./analysis/RunButterfly.cc:85:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(theCmmd.c_str());
^
/bin/rm -f lib_RunButterfly_temp.a
ar -qc lib_RunButterfly_temp.a obj/analysis/RunButterfly.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./RunButterfly
g++ -ggdb3 -fopenmp -o ./RunButterfly obj/analysis/RunButterfly.o -L. -lm -pthread -l_RunButterfly_temp
/bin/rm lib_RunButterfly_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:23 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/TranscriptomeFromVaryK.cc -o obj/analysis/TranscriptomeFromVaryK.o
./analysis/TranscriptomeFromVaryK.cc: In function ‘int main(int, char**)’:
./analysis/TranscriptomeFromVaryK.cc:216:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.lsize()-k; j++) {
^
./analysis/TranscriptomeFromVaryK.cc:218:22: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int x=j; x<j+k; x++) {
^
/bin/rm -f lib_TranscriptomeFromVaryK_temp.a
ar -qc lib_TranscriptomeFromVaryK_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/TranscriptomeFromVaryK.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./TranscriptomeFromVaryK
g++ -ggdb3 -fopenmp -o ./TranscriptomeFromVaryK obj/analysis/TranscriptomeFromVaryK.o -L. -lm -pthread -l_TranscriptomeFromVaryK_temp
/bin/rm lib_TranscriptomeFromVaryK_temp.a
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'
cd trinity-plugins && make trinity_essentials
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'
tar xvf seqtk-trinity.v0.0.2.tar.gz
seqtk-trinity-0.0.2/
seqtk-trinity-0.0.2/.gitignore
seqtk-trinity-0.0.2/LICENSE
seqtk-trinity-0.0.2/Makefile
seqtk-trinity-0.0.2/README.md
seqtk-trinity-0.0.2/khash.h
seqtk-trinity-0.0.2/kseq.h
seqtk-trinity-0.0.2/seqtk.c
seqtk-trinity-0.0.2/testing/
seqtk-trinity-0.0.2/testing/newformat_1.fq
seqtk-trinity-0.0.2/testing/newformat_2.fq
seqtk-trinity-0.0.2/testing/oldformat_1.fq
seqtk-trinity-0.0.2/testing/oldformat_2.fq
cd seqtk-trinity-0.0.2 && make
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'
gcc -g -Wall -O2 -Wno-unused-function seqtk.c -o seqtk-trinity -lz -lm
seqtk.c: In function ‘stk_comp’:
seqtk.c:444:16: warning: variable ‘lc’ set but not used [-Wunused-but-set-variable]
int la, lb, lc, na, nb, nc, cnt[11];
^
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'
mv seqtk-trinity-0.0.2/seqtk-trinity ./BIN/.
tar -zxvf "ParaFly-0.1.0".tar.gz && \
cd "ParaFly-0.1.0" && sh ./configure --prefix=`pwd` && make install && \
cp bin/ParaFly ../BIN/
ParaFly-0.1.0/
ParaFly-0.1.0/LICENSE
ParaFly-0.1.0/Makefile
ParaFly-0.1.0/Makefile.am
ParaFly-0.1.0/Makefile.in
ParaFly-0.1.0/README.md
ParaFly-0.1.0/aclocal.m4
ParaFly-0.1.0/bin/
ParaFly-0.1.0/bin/ParaFly
ParaFly-0.1.0/config.h
ParaFly-0.1.0/config.h.in
ParaFly-0.1.0/config.log
ParaFly-0.1.0/config.status
ParaFly-0.1.0/configure
ParaFly-0.1.0/configure.ac
ParaFly-0.1.0/depcomp
ParaFly-0.1.0/install-sh
ParaFly-0.1.0/missing
ParaFly-0.1.0/src/
ParaFly-0.1.0/src/.deps/
ParaFly-0.1.0/src/.deps/ParaFly.Po
ParaFly-0.1.0/src/.deps/argProcessor.Po
ParaFly-0.1.0/src/Makefile
ParaFly-0.1.0/src/Makefile.am
ParaFly-0.1.0/src/Makefile.in
ParaFly-0.1.0/src/ParaFly.cpp
ParaFly-0.1.0/src/argProcessor.cpp
ParaFly-0.1.0/src/argProcessor.hpp
ParaFly-0.1.0/stamp-h1
ParaFly-0.1.0/test/
ParaFly-0.1.0/test/Makefile
ParaFly-0.1.0/test/cmds.txt
ParaFly-0.1.0/test/rand_exit.pl
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for g++... g++
checking for C++ compiler default output file name... a.out
checking whether the C++ compiler works... yes
checking whether we are cross compiling... no
checking for suffix of executables...
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... gcc3
checking for library containing cos... none required
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
Making install in src
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
g++ -DHAVE_CONFIG_H -I. -I.. -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT ParaFly.o -MD -MP -MF .deps/ParaFly.Tpo -c -o ParaFly.o ParaFly.cpp
mv -f .deps/ParaFly.Tpo .deps/ParaFly.Po
g++ -DHAVE_CONFIG_H -I. -I.. -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp
mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po
g++ -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -o ParaFly ParaFly.o argProcessor.o
make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin"
/usr/bin/install -c ParaFly '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin'
make[4]: Nothing to be done for 'install-data-am'.
make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[4]: Nothing to be done for 'install-exec-am'.
make[4]: Nothing to be done for 'install-data-am'.
make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
ln -sf Trimmomatic-0.36 Trimmomatic
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'
sh ./util/support_scripts/trinity_install_tests.sh
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Performing Unit Tests of Build

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Inchworm: has been Installed Properly
Chrysalis: has been Installed Properly
QuantifyGraph: has been Installed Properly
GraphFromFasta: has been Installed Properly
ReadsToTranscripts: has been Installed Properly
parafly: has been Installed Properly
➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗
➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ ./Trinity

###############################################################################
#

______ ____ ____ ____ ____ ______ __ __
| || \ | || \ | || || | |
| || D ) | | | _ | | | | || | |
|_| |_|| / | | | | | | | |_| |_|| ~ |
| | | \ | | | | | | | | | |___, |
| | | . \ | | | | | | | | | | |
|__| |__|\_||____||__|__||____| |__| |____/

#
#
# Required:
#
# --seqType <string> :type of reads: ('fa' or 'fq')
#
# --max_memory :suggested max memory to use by Trinity where limiting can be enabled. (jellyfish, sorting, etc)
# provided in Gb of RAM, ie. '--max_memory 10G'
#
# If paired reads:
# --left :left reads, one or more file names (separated by commas, no spaces)
# --right :right reads, one or more file names (separated by commas, no spaces)
#
# Or, if unpaired reads:
# --single :single reads, one or more file names, comma-delimited (note, if single file contains pairs, can use flag: --run_as_paired )
#
# Or,
# --samples_file tab-delimited text file indicating biological replicate relationships.
# ex.
# cond_A cond_A_rep1 A_rep1_left.fq A_rep1_right.fq
# cond_A cond_A_rep2 A_rep2_left.fq A_rep2_right.fq
# cond_B cond_B_rep1 B_rep1_left.fq B_rep1_right.fq
# cond_B cond_B_rep2 B_rep2_left.fq B_rep2_right.fq
#
# # if single-end instead of paired-end, then leave the 4th column above empty.
#
####################################
## Misc: #########################
#
# --SS_lib_type :Strand-specific RNA-Seq read orientation.
# if paired: RF or FR,
# if single: F or R. (dUTP method = RF)
# See web documentation.
#
# --CPU :number of CPUs to use, default: 2
# --min_contig_length :minimum assembled contig length to report
# (def=200)
#
# --long_reads :fasta file containing error-corrected or circular consensus (CCS) pac bio reads
# (** note: experimental parameter **, this functionality continues to be under development)
#
# --genome_guided_bam :genome guided mode, provide path to coordinate-sorted bam file.
# (see genome-guided param section under --show_full_usage_info)
#
# --jaccard_clip :option, set if you have paired reads and
# you expect high gene density with UTR
# overlap (use FASTQ input file format
# for reads).
# (note: jaccard_clip is an expensive
# operation, so avoid using it unless
# necessary due to finding excessive fusion
# transcripts w/o it.)
#
# --trimmomatic :run Trimmomatic to quality trim reads
# see '--quality_trimming_params' under full usage info for tailored settings.
#
#
# --no_normalize_reads :Do *not* run in silico normalization of reads. Defaults to max. read coverage of 50.
# see '--normalize_max_read_cov' under full usage info for tailored settings.
# (note, as of Sept 21, 2016, normalization is on by default)
#
# --no_distributed_trinity_exec :do not run Trinity phase 2 (assembly of partitioned reads), and stop after generating command list.
#
#
# --output :name of directory for output (will be
# created if it doesn't already exist)
# default( your current working directory: "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity_out_dir"
# note: must include 'trinity' in the name as a safety precaution! )
#
# --workdir :where Trinity phase-2 assembly computation takes place (defaults to --output setting).
# (can set this to a node-local drive or RAM disk)
#
# --full_cleanup :only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta
#
# --cite :show the Trinity literature citation
#
# --verbose :provide additional job status info during the run.
#
# --version :reports Trinity version (Trinity-v2.6.6) and exits.
#
# --show_full_usage_info :show the many many more options available for running Trinity (expert usage).
#
#
###############################################################################
#
# *Note, a typical Trinity command might be:
#
# Trinity --seqType fq --max_memory 50G --left reads_1.fq --right reads_2.fq --CPU 6
#
#
# and for Genome-guided Trinity:
#
# Trinity --genome_guided_bam rnaseq_alignments.csorted.bam --max_memory 50G
# --genome_guided_max_intron 10000 --CPU 6
#
# see: /home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/sample_data/test_Trinity_Assembly/
# for sample data and 'runMe.sh' for example Trinity execution
#
# For more details, visit: http://trinityrnaseq.github.io
#
###############################################################################

]]> Rahul Nayak https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl Tue, 09 Jun 2015 23:38:44 -0500 https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl <![CDATA[Frequent words problem solution by Perl]]>

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

]]> Jit https://bioinformaticsonline.com/bookmarks/view/37457/nanofilt-filtering-and-trimming-of-long-read-sequencing-data Mon, 30 Jul 2018 12:01:52 -0500 https://bioinformaticsonline.com/bookmarks/view/37457/nanofilt-filtering-and-trimming-of-long-read-sequencing-data <![CDATA[nanofilt: Filtering and trimming of long read sequencing data]]> Filtering on quality and/or read length, and optional trimming after passing filters.
Reads from stdin, writes to stdout.

Intended to be used:

  • directly after fastq extraction
  • prior to mapping
  • in a stream between extraction and mapping

https://github.com/wdecoster/nanofilt

Address of the bookmark: https://github.com/wdecoster/nanofilt

]]> Jit https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl Wed, 10 Jun 2015 00:17:17 -0500 https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl <![CDATA[Clump Finding Problem Solved with Perl]]> The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

]]> Jit