<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31012?offset=890</link>
	<atom:link href="https://bioinformaticsonline.com/related/31012?offset=890" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10925/a-brief-bioinformatics-tutorial</guid>
	<pubDate>Wed, 21 May 2014 12:50:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10925/a-brief-bioinformatics-tutorial</link>
	<title><![CDATA[A Brief Bioinformatics Tutorial]]></title>
	<description><![CDATA[<p>This is about how to use a computer to find what is known about a gene of interest and also how to get new insights about it.</p>
<p>The tutorial is divided in three main parts:</p>
<ul>
<li>In the <strong>Sequence </strong>part, you will see how to look efficiently for a particular protein sequence, how to blast it against the database of your choice to find homologues, how to perform a multiple alignment of the homologues you've selected and how to edit this alignment.</li>
<li>The <strong>Structure </strong>part is about molecular visualization, homology modeling and structural domain prediction.</li>
<li>In the <strong>Function </strong>part, you will be introduced to you 3 useful servers to investigate the function of a protein. i.e. finding interactors, co-expressed genes, see a phylogenetic profile, easily access papers citing your gene etc ...</li>
</ul>
<p>During all the three parts, we will use the <em>S. cerevisiae </em>VPS36 protein as an example.</p><p>Address of the bookmark: <a href="http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html" rel="nofollow">http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</guid>
	<pubDate>Tue, 26 Dec 2017 22:23:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</link>
	<title><![CDATA[Magic-BLAST: a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome.]]></title>
	<description><![CDATA[<p>Magic-BLAST is a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome. Each alignment optimizes a composite score, taking into account simultaneously the two reads of a pair, and in case of RNA-seq, locating the candidate introns and adding up the score of all exons. This is very different from other versions of BLAST, where each exon is scored as a separate hit and read-pairing is ignored.</p>
<p>Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/26109056">(http://www.ncbi.nlm.nih.gov/pubmed/26109056)</a>, and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.</p><p>Address of the bookmark: <a href="https://ncbi.github.io/magicblast/" rel="nofollow">https://ncbi.github.io/magicblast/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11035/bioinformatics-jrfsrf-position-at-nii</guid>
  <pubDate>Sun, 25 May 2014 16:54:04 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics JRF/SRF position at NII]]></title>
  <description><![CDATA[
<p>NATIONAL INSTITUTE OF IMMUNOLOGY, NEW DELHI-110067</p>

<p>Applications are invited for the position of Senior Research Fellow for the following time-bound sponsored project as per the details given below:</p>

<p>1. BTIS project on, “Bioinformatics Center-National Infrastructural Facility in the Area of Immunology” funded by DBT</p>

<p>Senior Research Fellow (P) (One Position only)</p>

<p>Dr. Debasisa Mohanty<br />Staff Scientist-VI<br />deb@nii.res.in</p>

<p>Qualifications: M.Sc in Biological Sciences or Biotechnology with at least 04 years of Research experience in Bioinformatics or computational Biology after the master’s degree is essential.</p>

<p>Emoluments: The selected candidates will draw consolidated emoluments as per Institute Rules, depending upon qualifications &amp; experience</p>

<p>Rs. 18,000/- per month consolidated plus 30% HRA if Leading to Ph.D/NET/GATE Qualified otherwise Rs. 14,000/- per month + 30% HRA.</p>

<p>Job description: The candidate should be well versed in programming in PERL/C++/HTML/CGI, web server and portal development, computational analysis of<br />protein structure &amp; function, molecular dynamics simulations and use of high performance computing systems.</p>

<p>GENERAL TERMS AND CONDITIONS:-</p>

<p>1. The candidates selected for the above posts will be on contract for one year or duration of the project whichever is shorter, at a time.<br />2. No hostel/ housing facility will be provided.<br />3. Number of posts may vary and shall be need based. Advertisement is no commitment.<br />4. Applicants may clearly mention the category they belong to i.e. SC/ST/OBC/PH and attach documentary proof of the same.<br />5. No TA/DA will be paid for attending the interview, if called for.<br />6. Apart from sending application in the prescribed format given below, candidates should send complete Curriculum Vitae along with the names of three referees. Curriculum Vitae should contain details of the experimental expertise.</p>

<p>HOW TO APPLY Interested candidates may apply directly, STRICTLY IN THE PRESCRIBED FORMAT GIVEN BELOW, through e-mail, to the Investigator of the project, clearly indicating the name of the project along with their complete C.V., e-mail id, fax numbers, telephone numbers. Only Short listed candidates will be called for interview and they required to submit attested copies of all their certificates and a Demand Draft of Rs 100/- drawn on Canara Bank or Indian Bank payable at Delhi/New Delhi in favour of the Director, NII (SC / ST and PH candidates are exempted subject to submission of documentary proof), at the time of interview.</p>

<p>LAST DATE OF RECEIPT OF APPLICATIONS: 06th June, 2014</p>

<p>Advertisement</p>

<p>www1.nii.res.in/sites/default/files/projectappointment-Dr.Mohanty-6June2014.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13014/bioinformatics-jrf-vacancy-at-icgeb-new-delhi</guid>
  <pubDate>Wed, 23 Jul 2014 16:07:15 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics JRF vacancy at ICGEB, New Delhi]]></title>
  <description><![CDATA[
<p>Junior Research Fellow for a DBT sponsored project entitled "Computational and experimental characterization of stage specific arginine methylation in P. falciparum proteome". </p>

<p>Candidates should have a 1st class MSc/MTech/BTech degree in Bioinformatics. Please send complete CV, quoting Application for RMETH-JRF-2014, by email to Dr. Dinesh Gupta: dinesh@icgeb.res.in</p>

<p>Closing date for applications: 6 August 2014</p>

<p>More at http://www.icgeb.org/tl_files/Vacancies/JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</guid>
	<pubDate>Thu, 12 Apr 2018 10:00:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</link>
	<title><![CDATA[G-compass: a comparative genome browser]]></title>
	<description><![CDATA[<p><span>G-compass (</span><a href="http://www.h-invitational.jp/g-compass/" target="_top">http://www.h-invitational.jp/g-compass/</a><span>) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from&nbsp;</span><a href="http://www.h-invitational.jp/hinv/ahg-db/index.jsp" target="_top">H-InvDB</a><span>&nbsp;and its subdatabase&nbsp;</span><a href="http://www.h-invitational.jp/evola/" target="_top">Evola</a><span>, respectively. G-compass is available for free of charge. [&nbsp;</span><a href="http://www.h-invitational.jp/g-compass/cgi-bin/gc_main.cgi?species_1=Hg18&amp;species_2=pt2&amp;strand_1=%2B&amp;strand_2=%2B&amp;from_win=main&amp;gen_str=2&amp;chr_1=01&amp;chr_2=01&amp;st_1=103804298&amp;ed_1=104204297&amp;st_2=105235351&amp;ed_2=105635350" target="_top">Sample</a><span>&nbsp;]</span></p><p>Address of the bookmark: <a href="http://www.h-invitational.jp/g-compass/" rel="nofollow">http://www.h-invitational.jp/g-compass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11313/linux-sort-commands-for-bioinformatics</guid>
	<pubDate>Sat, 31 May 2014 15:41:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11313/linux-sort-commands-for-bioinformatics</link>
	<title><![CDATA[Linux Sort Commands for Bioinformatics]]></title>
	<description><![CDATA[<p>Almost all the scripting languages such as Perl, Python etc have built-in sort, but unfortunately none of them are as flexible as sort command. But one when it come to space efficiency GNU sort stands at the top. It can sort a 20Gb file with less than 2Gb memory. It is not trivial to implement so powerful a sort by yourself.</p><p>sort a space-delimited file based on its first column, then the second if the first is the same, and so on:<br />sort input.txt</p><p>sort a huge file (GNU sort ONLY):<br />sort -S 1500M -t $HOME/tmp input.txt &gt; sorted.txt</p><p>sort starting from the third column, skipping the first two columns:<br />sort +2 input.txt</p><p>sort the second column as numbers, descending order; if identical, sort the 3rd as strings, ascending order:<br />sort -k2,2nr -k3,3 input.txt</p><p>sort starting from the 4th character at column 2, as numbers:<br />sort -k2.4n input.txt</p><p>More Linxu sort command information<br /><br />If you have any sort commands you'd like to share, please add them to our comments section below. For more help, you can also type:<br /><br />man sort<br /><br />or<br /><br />sort --help<br /><br />on your Unix/Linux system.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</guid>
	<pubDate>Tue, 15 May 2018 09:42:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</link>
	<title><![CDATA[Circlator: automated circularization of genome assemblies using long sequencing reads]]></title>
	<description><![CDATA[A tool to circularize genome assemblies. The algorithm and benchmarks are described in the Genome Biology manuscript. 

Citation: "Circlator: automated circularization of genome assemblies using long sequencing reads", Hunt et al, Genome Biology 2015 Dec 29;16(1):294. doi: 10.1186/s13059-015-0849-0. PMID: 26714481.<p>Address of the bookmark: <a href="http://sanger-pathogens.github.io/circlator/" rel="nofollow">http://sanger-pathogens.github.io/circlator/</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11494/postdoc-position-at-centre-mediterraneen-de-medecine-moleculaire-nice-france</guid>
  <pubDate>Wed, 04 Jun 2014 07:20:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc position at Centre Méditerranéen de Médecine Moléculaire - Nice - France]]></title>
  <description><![CDATA[
<p>The research group of Dr. Michele Trabucchi at the Centre Méditerranéen de Médecine Moléculaire (C3M) at INSERM U1065 (University of Nice Sophia-Antipolis, France) is seeking candidates for a Postdoctoral fellow position to start on October 2014 for 3 years funded by FRM (Fondation pour la Recherche Médicale).<br />The broad interest of the lab is in understanding the expression control and function of small RNAs in activated myeloid cells (visit our webpage to check research interests and publications of the group : http://www.unice.fr/c3m/EN/Equipe10.html ). </p>

<p>The work will focus on the functional studies of small RNAs by using next-generation sequencing approaches.<br /> <br />Candidates should hold a Ph.D. degree and have strong background in bioinformatics.<br />The University of Nice Sophia-Antipolis provides a wide range of facilities and training essential for biomedical research.</p>

<p>Interested applicants should send a PDF with a cover letter stating research interests and qualifications, an updated CV, a summary of previous research experience and contact information for two references to Michele Trabucchi ( mtrabucchi@unice.fr )</p>

<p>Homepage: http://www.unice.fr/c3m/EN/Equipe10.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>