<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31014?offset=1650</link>
	<atom:link href="https://bioinformaticsonline.com/related/31014?offset=1650" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39674/simka-and-simkamin-are-comparative-metagenomics-method-dedicated-to-ngs-datasets</guid>
	<pubDate>Sat, 06 Jul 2019 13:56:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39674/simka-and-simkamin-are-comparative-metagenomics-method-dedicated-to-ngs-datasets</link>
	<title><![CDATA[Simka and SimkaMin are comparative metagenomics method dedicated to NGS datasets]]></title>
	<description><![CDATA[<p>Simka is a de novo comparative metagenomics tool. Simka represents each dataset as a k-mer spectrum and compute several classical ecological distances between them.</p>
<p>Developper:&nbsp;<a href="http://people.rennes.inria.fr/Gaetan.Benoit/">Ga&euml;tan Benoit</a>, PhD, former member of the&nbsp;<a href="http://team.inria.fr/genscale/">Genscale</a>&nbsp;team at Inria.</p>
<p>Contact: claire dot lemaitre at inria dot fr</p>
<p><span>Simka and SimkaMin are comparative metagenomics method dedicated to NGS datasets.&nbsp;</span><span></span><span><a href="https://gatb.inria.fr/software/simka/">https://gatb.inria.fr/software/simka/</a></span></p><p>Address of the bookmark: <a href="https://github.com/GATB/simka" rel="nofollow">https://github.com/GATB/simka</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/40770/scientist-bioinformatics-positions</guid>
  <pubDate>Thu, 30 Jan 2020 06:53:40 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist Bioinformatics Positions]]></title>
  <description><![CDATA[
<p>Bioinformatics-Multi_Omics_Integration</p>

<p>https://www.researchgate.net/job/939073_Senior_Scientist_Bioinformatics-Multi_Omics_Integration</p>

<p> <br />Senior_Scientist_Bioinformatics-Transcriptomics_Analysis     </p>

<p>https://www.researchgate.net/job/939075_Senior_Scientist_Bioinformatics-Transcriptomics_Analysis-Belgium_France_Switzerland_The_Netherlands</p>

<p>Senior Scientist Bioinformatics - Network Analytics</p>

<p>https://www.researchgate.net/job/939070_Senior_Scientist_Bioinformatics-Network_Analytics_Belgium_France_Switzerland_the_Netherlands</p>

<p>Team Leader Bioinformatics Data Sciences - Mechelen, Belgium</p>

<p>https://www.researchgate.net/job/938787_Team_Leader_Bioinformatics_Data_Sciences-Mechelen_Belgium</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42329/10-ngs-services-companies-around-the-globe</guid>
	<pubDate>Sun, 22 Nov 2020 23:56:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42329/10-ngs-services-companies-around-the-globe</link>
	<title><![CDATA[10 NGS services companies around the globe !]]></title>
	<description><![CDATA[<p><strong>The global&nbsp;NGS services market&nbsp;is expected to reach USD 13.1 billion by 2025.&nbsp;</strong>Here are the&nbsp;<strong style="font-size: 12.8px;">top 10 NGS services companies to look for &ndash;</strong></p><p><strong>1.&nbsp;<a href="https://www.illumina.com/">Illumina, Inc. (U.S.)</a></strong></p><p>Illumina, Inc. was founded in 1998 and is headquartered at San Diego, U.S. Illumina, Inc. is one of the leading players in DNA sequencing and array-based technologies, serving customers in the research, clinical, and applied markets. The company offers products for applications in the life sciences, oncology, reproductive health, agriculture, and other emerging segments. The company serves government laboratories, genomic research centers, academics institutions as well as pharmaceutical, biotechnology, agrigenomics, commercial molecular diagnostics laboratories and consumer genomics companies. Illumina, Inc. has its geographic presence in North America, Europe, Latin America, Asia-pacific, and others.</p><p><strong>2.&nbsp;<a href="https://www.qiagen.com/us/">QIAGEN N.V. (Netherlands)</a></strong></p><p>QIAGEN N.V. was incorporated in 1986 and is headquartered at Venlo, The Netherlands. The Company is engaged in providing Sample to Insight solutions that transform biological samples into molecular insights. QIAGEN provides its workflow to customers in molecular diagnostics, assay technologies, bioservices and automation systems.&nbsp; The company&rsquo;s genome services are suitable for custom/tailored projects that allow access to genomic sequence information.&nbsp; The Company market its products in more than 100 countries across the Americas, Europe, Asia, Australia, and the Middle-East &amp;Africa through its subsidiaries and channel partners.</p><p><strong>3.&nbsp;<a href="https://www.perkinelmer.com/">PerkinElmer, Inc. (U.S.)</a></strong></p><p>PerkinElmer, Inc. was founded in 1947 and is headquartered in Waltham, Massachusetts, the U.S. PerkinElmer, Inc. offers its products &amp; services and solutions for the diagnostics, food, environmental, industrial, life sciences research and laboratory services markets. The company offer comprehensive genetic testing solutions that help to provide insight into the complex nature of rare and inherited diseases. Some of the subsidiaries of the company are Caliper Life Sciences, Improvision, Viacell Inc., ViaCord LLC, among many others. The company has its facilities located in Europe (France, Germany, and Belgium), U.S. and Asia (China, India, and Japan).</p><p><strong>4.&nbsp;<a href="https://www.eurofins.com/">Eurofins Scientific SE (Luxembourg)</a></strong></p><p>Eurofins Scientific SE was founded in 1987 and is headquartered in Luxembourg, Europe. The company offers a portfolio of over 130,000 analytical methods and more than 150 million assays performed each year to establish the safety, identity, composition, authenticity, origin, traceability, and purity of biological substances and products, as well as carry out human diagnostic services. The company has its geographic presence across 39 countries in Europe, North and South America, and Asia-Pacific.</p><p><strong>5.&nbsp;<a href="https://www.gatc-biotech.com/en/index.html">GATC Biotech AG (Germany)</a></strong></p><p>GATC Biotech AG was founded in 1990 and is headquartered in Constance, Germany. The company provides DNA and RNA sequencing and bioservices solutions to academics and industrial areas. It also provides next generation sequencing services including genomes, targeted (re)-sequencing, human sample sequencing, transcriptomes, metagenomes, regulomes, pre-sequencing, NGS barcode labels, and next generation sequencing technologies; and bioservices services, including bioservices tools, pipelines and workflows, compute resources, data analysis reports, and case studies. GATC Biotech AG operates as a subsidiary of Eurofins Scientific SE. It offers its products through distributors in Italy, Japan, Portugal, Spain, and the Czech Republic.</p><p><strong>6.<a href="https://www.macrogen.com/">&nbsp;Macrogen, Inc. (South Korea)</a></strong></p><p>Macrogen, Inc. was founded in 1997 and is headquartered in Seoul, South Korea. Macrogen, Inc. provides next generation sequencing services such as whole genome, de novo, exome, targeted, transcriptomics, metagenome, and epigenome sequencing.&nbsp; The company also provides a variety of services such as oligo synthesis, database construction, genome research, and bioservices analysis system consulting services. Macrogen, Inc. provides genome research services in Korea and internationally.</p><p><strong>7.&nbsp;<a href="https://www.genotypic.co.in/">Genotypic Technology Pvt. Ltd. (India)</a></strong></p><p>Genotypic Technology Pvt. Ltd. was incorporated in 1998 and is headquartered in Bangalore, India. Genotypic Technology is the first Genomics service provider in India providing Microarray, Next Generation Sequencing (NGS), Bioservices and solutions to domestic/ international pharma, biotech companies and academia. The company provides its services for protocol optimization, probe designing, array layouts, project designing, and nucleic acid analysis to in-depth analysis. Genotypic Technology has its geographic presence in North America, Europe, Asia Pacific, Middle East &amp; Africa, and Latin America.</p><p><strong>8.&nbsp;<a href="https://www.genewiz.com/">GENEWIZ, Inc. (U.S.)</a></strong></p><p>GENEWIZ, Inc. was founded in 1999 and is headquartered in South Plainfield, New Jersey, the U.S.; The company is a leading provider of research service in the field of Next Generation Sequencing, Sanger DNA sequencing, sequencing of bacteria and phage, gene synthesis, DNA cloning, genomics including mutation analysis, single nucleotide polymorphism, and bioservices. GENEWIZ, Inc. has its geographic presence in U.S., China, Germany, France, Japan, and the U.K.</p><p><strong>9.&nbsp;<a href="https://www.genomics.cn/">Beijing Genomics Institute (China)</a></strong></p><p>Beijing Genomics Institute (BGI) is the world&rsquo;s largest genomics organization and non-profit research institution that was founded in 1999 and is headquartered in Shenzhen, China. The Company provides a wide range of commercial next generation sequencing services and genetic tests for medical institutions, agricultural and environmental applications. The Company operates all across the globe through its subsidiaries, namely, BGI China (Mainland), BGI Asia Pacific, BGI Americas (North and South America) and BGI Europe (Europe and Africa).</p><p><strong>10.&nbsp;<a href="https://www.scigenom.com/">SciGenom Labs Pvt. Ltd (India)</a></strong></p><p>SciGenom Labs Pvt. Ltd was founded in 2010 and is headquartered in Cochin, India with offices in Chennai &amp; Hyderabad in India, and San Francisco in the U.S. It is a Genomics R&amp;D services company that provides genomic sequencing and NGS services to life sciences and healthcare businesses globally as well as academic and government institutions in India.</p><p>Popular mentions &ndash; MedGenome (India), DNA Link, Inc. (South Korea), Otogenetics Corporation (U.S.), Novogene Corporation (China), LGC Limited (U.K.), CD Genomics (U.S.), SeqLL, LLC (U.S.)</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43828/understanding-hifi-reads</guid>
	<pubDate>Thu, 24 Mar 2022 19:48:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43828/understanding-hifi-reads</link>
	<title><![CDATA[Understanding HiFi Reads !]]></title>
	<description><![CDATA[<p><span>While little public data is available for either of the new synthetic long read approaches, Illumina showed an example comparison earlier this year at the&nbsp;</span><a href="https://www.festivalofgenomics.com/rami-mehio" target="_blank">Festival of Genomics &amp; Biodata conference</a><span>&nbsp;(FoG 2022). In the IGV screenshot presented (below), synthetic Infinity reads &ndash; labeled &ldquo;Longas&rdquo; &ndash; are at the top, followed by standard Illumina short reads, and PacBio HiFi reads labeled &ldquo;CCS&rdquo; depicted at the bottom:</span></p><p>Address of the bookmark: <a href="http://pacb.com/blog/the-hifi-difference-true-long-reads-vs-synthetic-long-reads/" rel="nofollow">http://pacb.com/blog/the-hifi-difference-true-long-reads-vs-synthetic-long-reads/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42972/list-of-bioinformatics-workflow-management-tools</guid>
	<pubDate>Sat, 20 Mar 2021 00:15:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42972/list-of-bioinformatics-workflow-management-tools</link>
	<title><![CDATA[List of bioinformatics workflow management tools !]]></title>
	<description><![CDATA[<h3>Here are list of&nbsp;Workflow Managers</h3><ul>
<li><span><a href="https://github.com/pcingola/BigDataScript">BigDataScript</a></span>&nbsp;&ndash; A cross-system scripting language for working with big data pipelines in computer systems of different sizes and capabilities. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/25189778">paper-2014</a>&nbsp;|&nbsp;<a href="https://pcingola.github.io/BigDataScript">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/ssadedin/bpipe">Bpipe</a></span>&nbsp;&ndash; A small language for defining pipeline stages and linking them together to make pipelines. [&nbsp;<a href="http://docs.bpipe.org/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/common-workflow-language/common-workflow-language">Common Workflow Language</a></span>&nbsp;&ndash; a specification for describing analysis workflows and tools that are portable and scalable across a variety of software and hardware environments, from workstations to cluster, cloud, and high performance computing (HPC) environments. [&nbsp;<a href="http://www.commonwl.org/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/broadinstitute/cromwell">Cromwell</a></span>&nbsp;&ndash; A Workflow Management System geared towards scientific workflows. [&nbsp;<a href="https://cromwell.readthedocs.io/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/galaxyproject">Galaxy</a></span>&nbsp;&ndash; a popular open-source, web-based platform for data intensive biomedical research. Has several features, from data analysis to workflow management to visualization tools. [&nbsp;<a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6030816">paper-2018</a>&nbsp;|&nbsp;<a href="https://galaxyproject.org/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/nextflow-io/nextflow">Nextflow</a>&nbsp;(recommended)</span>&nbsp;&ndash; A fluent DSL modelled around the UNIX pipe concept, that simplifies writing parallel and scalable pipelines in a portable manner. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/29412134">paper-2018</a>&nbsp;|&nbsp;<a href="http://nextflow.io/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/cgat-developers/ruffus">Ruffus</a></span>&nbsp;&ndash; Computation Pipeline library for python widely used in science and bioinformatics. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/20847218">paper-2010</a>&nbsp;|&nbsp;<a href="http://www.ruffus.org.uk/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/SeqWare/seqware">SeqWare</a></span>&nbsp;&ndash; Hadoop Oozie-based workflow system focused on genomics data analysis in cloud environments. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/21210981">paper-2010</a>&nbsp;|&nbsp;<a href="https://seqware.github.io/">web</a>&nbsp;]</li>
<li><span><a href="https://bitbucket.org/snakemake">Snakemake</a></span>&nbsp;&ndash; A workflow management system in Python that aims to reduce the complexity of creating workflows by providing a fast and comfortable execution environment. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/29788404">paper-2018</a>&nbsp;|&nbsp;<a href="https://snakemake.readthedocs.io/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/broadinstitute/wdl">Workflow Descriptor Language</a></span>&nbsp;&ndash; Workflow standard developed by the Broad. [&nbsp;<a href="https://software.broadinstitute.org/wdl">web</a>&nbsp;]</li>
</ul>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38535/nanopack-visualizing-and-processing-long-read-sequencing-data</guid>
	<pubDate>Tue, 25 Dec 2018 21:20:50 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38535/nanopack-visualizing-and-processing-long-read-sequencing-data</link>
	<title><![CDATA[NanoPack: visualizing and processing long-read sequencing data]]></title>
	<description><![CDATA[The NanoPack tools are written in Python3 and released under the GNU GPL3.0 License. The source code can be found at https://github.com/wdecoster/nanopack, together with links to separate scripts and their documentation. The scripts are compatible with Linux, Mac OS and the MS Windows 10 subsystem for Linux and are available as a graphical user interface, a web service at http://nanoplot.bioinf.be and command line tools.<p>Address of the bookmark: <a href="https://github.com/wdecoster/nanopack" rel="nofollow">https://github.com/wdecoster/nanopack</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>