<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31018?offset=830</link>
	<atom:link href="https://bioinformaticsonline.com/related/31018?offset=830" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/28051/convert-ensembl-gtf-to-annotation-table-geneid-genesymbol-genewisechrlocation-geneclass-strand-raw</guid>
	<pubDate>Fri, 24 Jun 2016 18:08:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/28051/convert-ensembl-gtf-to-annotation-table-geneid-genesymbol-genewisechrlocation-geneclass-strand-raw</link>
	<title><![CDATA[Convert EnsEMBL GTF to Annotation table (Geneid, GeneSymbol, GeneWiseChrLocation, GeneClass, Strand) Raw]]></title>
	<description><![CDATA[<p><strong>Bash Script source:</strong></p><p>https://gist.github.com/santhilalsubhash/367befcf5216be4b1fd9</p><p>&nbsp;</p><p><strong>Information</strong>:</p><p>This script converts EnsEMBL GTF (Ex:&nbsp;<a href="https://gist.githubusercontent.com/santhilalsubhash/1e7cca357e52a181dc25/raw/cfb803e07900a2baefbb6534f1299fd30cb57a29/sample.GTF">https://gist.githubusercontent.com/santhilalsubhash/1e7cca357e52a181dc25/raw/cfb803e07900a2baefbb6534f1299fd30cb57a29/sample.GTF</a>) file to annotation table format. It generated two files<br />1) Transcript wise chromosome location with information about transcripts (Ex:&nbsp;<a href="https://gist.githubusercontent.com/santhilalsubhash/c7dec516e0338503a4b6/raw/de0af1a39f0005c4ce7321c5ae57fc8b4a14c7f4/sample.GTF_enst_annotation.txt">https://gist.githubusercontent.com/santhilalsubhash/c7dec516e0338503a4b6/raw/de0af1a39f0005c4ce7321c5ae57fc8b4a14c7f4/sample.GTF_enst_annotation.txt</a>)<br />2) Gene wise chromosome location with information about genes (Ex:&nbsp;<a href="https://gist.githubusercontent.com/santhilalsubhash/c92006c5080f0333bec2/raw/d16e0b2440d73b09b486d3c9751cdb248a73fa0b/sample.GTF_ensg_annotation.txt">https://gist.githubusercontent.com/santhilalsubhash/c92006c5080f0333bec2/raw/d16e0b2440d73b09b486d3c9751cdb248a73fa0b/sample.GTF_ensg_annotation.txt</a>)</p><p>Note: You can download GTF files from&nbsp;<a href="http://www.ensembl.org/info/data/ftp/index.html">http://www.ensembl.org/info/data/ftp/index.html</a></p>]]></description>
	<dc:creator>EagleEye</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37957/base-a-practical-de-novo-assembler-for-large-genomes-using-long-ngs-reads</guid>
	<pubDate>Fri, 19 Oct 2018 07:25:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37957/base-a-practical-de-novo-assembler-for-large-genomes-using-long-ngs-reads</link>
	<title><![CDATA[BASE: a practical de novo assembler for large genomes using long NGS reads]]></title>
	<description><![CDATA[<p><span>new&nbsp;</span><em>de novo</em><span>&nbsp;assembler called BASE. It enhances the classic seed-extension approach by indexing the reads efficiently to generate adaptive seeds that have high probability to appear uniquely in the genome. Such seeds form the basis for BASE to build extension trees and then to use reverse validation to remove the branches based on read coverage and paired-end information, resulting in high-quality consensus sequences of reads sharing the seeds. Such consensus sequences are then extended to contigs.</span></p><p>Address of the bookmark: <a href="https://github.com/dhlbh/BASE" rel="nofollow">https://github.com/dhlbh/BASE</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38829/nquire-a-statistical-framework-for-ploidy-estimation-using-ngs-short-read-data</guid>
	<pubDate>Thu, 31 Jan 2019 05:12:19 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38829/nquire-a-statistical-framework-for-ploidy-estimation-using-ngs-short-read-data</link>
	<title><![CDATA[nQuire: A statistical framework for ploidy estimation using NGS short-read data]]></title>
	<description><![CDATA[<p>nQuire implements a set of commands to estimate ploidy level of individuals from species, where recent polyploidization occurred and intraspecific ploidy variation is observed. Specifically, nQuire uses next-generation sequencing data to distinguish between diploids, triploids and tetraploids, on the basis of frequency distributions at variant sites where only two bases are segregating.</p>
<p>For more background see also the publication at&nbsp;<a href="https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2128-z">BMC Bioinformatics</a>.</p>
<p>https://github.com/clwgg/nQuire</p><p>Address of the bookmark: <a href="https://github.com/clwgg/nQuire" rel="nofollow">https://github.com/clwgg/nQuire</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40546/clincnv-detection-of-copy-number-changes-in-germlinetriosomatic-contexts-in-ngs-data</guid>
	<pubDate>Thu, 16 Jan 2020 23:16:02 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40546/clincnv-detection-of-copy-number-changes-in-germlinetriosomatic-contexts-in-ngs-data</link>
	<title><![CDATA[ClinCNV: Detection of copy number changes in Germline/Trio/Somatic contexts in NGS data]]></title>
	<description><![CDATA[<p><span>ClinCNV detects CNVs in germline and somatic context in NGS data (targeted and whole-genome). We work in cohorts, so it makes sense to try&nbsp;</span><code>ClinCNV</code><span>&nbsp;if you have more than 10 samples (recommended amount - 40 since we estimate variances from the data). By "cohort" we mean samples sequenced with the same enrichment kit with approximately the same depth (ie 1x WGS and 30x WGS better be analysed in separate runs of ClinCNV). Of course it is better if your samples were sequenced within the same sequencing facility.</span></p><p>Address of the bookmark: <a href="https://github.com/imgag/ClinCNV" rel="nofollow">https://github.com/imgag/ClinCNV</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41146/lofreq-a-sequence-quality-aware-ultra-sensitive-variant-caller-for-ngs-data</guid>
	<pubDate>Tue, 18 Feb 2020 03:24:22 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41146/lofreq-a-sequence-quality-aware-ultra-sensitive-variant-caller-for-ngs-data</link>
	<title><![CDATA[LoFreq*: A sequence-quality aware, ultra-sensitive variant caller for NGS data]]></title>
	<description><![CDATA[<p>LoFreq* (i.e. LoFreq version 2) is a fast and sensitive variant-caller for inferring SNVs and indels from next-generation sequencing data. It makes full use of base-call qualities and other sources of errors inherent in sequencing (e.g. mapping or base/indel alignment uncertainty), which are usually ignored by other methods or only used for filtering.</p>
<p>https://github.com/CSB5/lofreq</p>
<p>http://csb5.github.io/lofreq/installation/</p>
<p>https://github.com/CSB5/lofreq/tree/master/dist</p><p>Address of the bookmark: <a href="http://csb5.github.io/lofreq/" rel="nofollow">http://csb5.github.io/lofreq/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42917/fings-filters-for-next-generation-sequencing</guid>
	<pubDate>Sat, 27 Feb 2021 01:18:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42917/fings-filters-for-next-generation-sequencing</link>
	<title><![CDATA[FiNGS: Filters for Next Generation Sequencing]]></title>
	<description><![CDATA[<h2>Key features</h2>
<ul>
<li><strong>Filters SNVs from any variant caller to remove false positives</strong></li>
<li><strong>Calculates metrics based on BAM files and provides filtering not possible with other tools</strong></li>
<li><strong>Fully user-configurable filtering (including which filters to use and their thresholds)</strong></li>
<li><strong>Option to use filters identical to ICGC recommendations</strong></li>
</ul>
<p>FiNGS provides researchers with a tool to reproducibly filter somatic variants that is simple to both deploy and use, with filters and thresholds that are fully configurable by the user. It ingests and emits standard variant call format (VCF) files and will slot into existing sequencing pipelines. It allows users to develop and implement their own filtering strategies and simple sharing of these with others.</p>
<p>FiNGS reliably improves upon the precision of default variant caller outputs and performs better than other tools designed for the same task.</p><p>Address of the bookmark: <a href="https://github.com/cpwardell/FiNGS" rel="nofollow">https://github.com/cpwardell/FiNGS</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>