BOL: Related items

Convert EnsEMBL GTF to Annotation table (Geneid, GeneSymbol, GeneWiseChrLocation, GeneClass, Strand) Raw

EagleEye — Fri, 24 Jun 2016 18:08:49 -0500

Bash Script source:

https://gist.github.com/santhilalsubhash/367befcf5216be4b1fd9

Information:

This script converts EnsEMBL GTF (Ex: https://gist.githubusercontent.com/santhilalsubhash/1e7cca357e52a181dc25/raw/cfb803e07900a2baefbb6534f1299fd30cb57a29/sample.GTF) file to annotation table format. It generated two files
1) Transcript wise chromosome location with information about transcripts (Ex: https://gist.githubusercontent.com/santhilalsubhash/c7dec516e0338503a4b6/raw/de0af1a39f0005c4ce7321c5ae57fc8b4a14c7f4/sample.GTF_enst_annotation.txt)
2) Gene wise chromosome location with information about genes (Ex: https://gist.githubusercontent.com/santhilalsubhash/c92006c5080f0333bec2/raw/d16e0b2440d73b09b486d3c9751cdb248a73fa0b/sample.GTF_ensg_annotation.txt)

Note: You can download GTF files from http://www.ensembl.org/info/data/ftp/index.html

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

BASE: a practical de novo assembler for large genomes using long NGS reads

Rahul Nayak — Fri, 19 Oct 2018 07:25:21 -0500

new de novo assembler called BASE. It enhances the classic seed-extension approach by indexing the reads efficiently to generate adaptive seeds that have high probability to appear uniquely in the genome. Such seeds form the basis for BASE to build extension trees and then to use reverse validation to remove the branches based on read coverage and paired-end information, resulting in high-quality consensus sequences of reads sharing the seeds. Such consensus sequences are then extended to contigs.

Address of the bookmark: https://github.com/dhlbh/BASE

nQuire: A statistical framework for ploidy estimation using NGS short-read data

Jit — Thu, 31 Jan 2019 05:12:19 -0600

nQuire implements a set of commands to estimate ploidy level of individuals from species, where recent polyploidization occurred and intraspecific ploidy variation is observed. Specifically, nQuire uses next-generation sequencing data to distinguish between diploids, triploids and tetraploids, on the basis of frequency distributions at variant sites where only two bases are segregating.

For more background see also the publication at BMC Bioinformatics.

https://github.com/clwgg/nQuire

Address of the bookmark: https://github.com/clwgg/nQuire

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

ClinCNV: Detection of copy number changes in Germline/Trio/Somatic contexts in NGS data

Neel — Thu, 16 Jan 2020 23:16:02 -0600

ClinCNV detects CNVs in germline and somatic context in NGS data (targeted and whole-genome). We work in cohorts, so it makes sense to try ClinCNV if you have more than 10 samples (recommended amount - 40 since we estimate variances from the data). By "cohort" we mean samples sequenced with the same enrichment kit with approximately the same depth (ie 1x WGS and 30x WGS better be analysed in separate runs of ClinCNV). Of course it is better if your samples were sequenced within the same sequencing facility.

Address of the bookmark: https://github.com/imgag/ClinCNV

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

LoFreq*: A sequence-quality aware, ultra-sensitive variant caller for NGS data

BioStar — Tue, 18 Feb 2020 03:24:22 -0600

LoFreq* (i.e. LoFreq version 2) is a fast and sensitive variant-caller for inferring SNVs and indels from next-generation sequencing data. It makes full use of base-call qualities and other sources of errors inherent in sequencing (e.g. mapping or base/indel alignment uncertainty), which are usually ignored by other methods or only used for filtering.

https://github.com/CSB5/lofreq

http://csb5.github.io/lofreq/installation/

https://github.com/CSB5/lofreq/tree/master/dist

Address of the bookmark: http://csb5.github.io/lofreq/

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

FiNGS: Filters for Next Generation Sequencing

Neel — Sat, 27 Feb 2021 01:18:35 -0600

Key features

Filters SNVs from any variant caller to remove false positives
Calculates metrics based on BAM files and provides filtering not possible with other tools
Fully user-configurable filtering (including which filters to use and their thresholds)
Option to use filters identical to ICGC recommendations

FiNGS provides researchers with a tool to reproducibly filter somatic variants that is simple to both deploy and use, with filters and thresholds that are fully configurable by the user. It ingests and emits standard variant call format (VCF) files and will slot into existing sequencing pipelines. It allows users to develop and implement their own filtering strategies and simple sharing of these with others.

FiNGS reliably improves upon the precision of default variant caller outputs and performs better than other tools designed for the same task.

Address of the bookmark: https://github.com/cpwardell/FiNGS