BOL: Related items

LoFreq*: A sequence-quality aware, ultra-sensitive variant caller for NGS data

BioStar — Tue, 18 Feb 2020 03:24:22 -0600

LoFreq* (i.e. LoFreq version 2) is a fast and sensitive variant-caller for inferring SNVs and indels from next-generation sequencing data. It makes full use of base-call qualities and other sources of errors inherent in sequencing (e.g. mapping or base/indel alignment uncertainty), which are usually ignored by other methods or only used for filtering.

https://github.com/CSB5/lofreq

http://csb5.github.io/lofreq/installation/

https://github.com/CSB5/lofreq/tree/master/dist

Address of the bookmark: http://csb5.github.io/lofreq/

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

FiNGS: Filters for Next Generation Sequencing

Neel — Sat, 27 Feb 2021 01:18:35 -0600

Key features

Filters SNVs from any variant caller to remove false positives
Calculates metrics based on BAM files and provides filtering not possible with other tools
Fully user-configurable filtering (including which filters to use and their thresholds)
Option to use filters identical to ICGC recommendations

FiNGS provides researchers with a tool to reproducibly filter somatic variants that is simple to both deploy and use, with filters and thresholds that are fully configurable by the user. It ingests and emits standard variant call format (VCF) files and will slot into existing sequencing pipelines. It allows users to develop and implement their own filtering strategies and simple sharing of these with others.

FiNGS reliably improves upon the precision of default variant caller outputs and performs better than other tools designed for the same task.

Address of the bookmark: https://github.com/cpwardell/FiNGS

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Libraries or management tools for high throughput sequencing data

LEGE — Fri, 04 Oct 2024 02:45:06 -0500

GATB Library. The Genome Analysis Toolbox with de-Bruijn graph. A large part of tools developed by the GenScale team are based on this library.
These methods enable the analysis of data sets of any size on multi-core desktop computers, including very huge amount of reads data coming from any kind of organisms such as bacteria, plants, animals and even complex samples (e.g. metagenomes). Among them are (the full is available here: https://gatb.inria.fr/software/):
LRez: C++ Library and toolkit for the barcode-based management and indexation of linked-read datasets.

Variant calling and/or genotyping

DiscoSNP++ and discoSnpRAD: Reference-free small variant discovery (SNPs and indels)
MindTheGap: Detection and assembly of large insertion variants
TakeABreak: reference-free inversion discovery tool
SVJedi: Structural Variant genotyper with long read data
SVJedi-graph: Structural Variant genotyper with long read data using a variation graph

Sequence assembly

MinYS: reference-guided genome assembly in metagenomics data
MTG-link: local assembly tool for linked-read data
Minia: De novo short read assembler
de-novo pipeline: de-novo assembly pipeline (error correction / contigs / scaffolding) for genomes and meta-genomes
Mapsembler2: Targeted assembly (not maintained)

Managing k-mers & indexation

findere: simple strategy for speeding up queries and for reducing false positive calls from any Approximate Membership Query data structure.
- fimpera extends findere adding the abundance information.
kmtricks: modular tool suite for counting kmers, and constructing Bloom filters or kmer matrices, for large collections of sequencing data.
kmindex is a tool for indexing and querying sequencing samples. It is built on top of kmtricks.
back to sequences: Find sequences (reads, unitigs, genes) related to a set of kmers in large datasets, in a matter of seconds.
Backpack Quotient Filter: k-mer indexing data structure with abundance
short read connector: Detect similar reads from potentially large read set
DSK: Count K-mer in sequences

Pangenome graph manipulation

Pancat: Pangenome Comparison and Analysis Toolkit
GFAGraphs: a Python library to handle pangenome graph files in GFA format.

Comparative metagenomics with k-mers

Simka and SimkaMin: Comparative metagenomics for large-scale datasets
Comparead & Commet: comparison of metagenomic datasets

Species and bacterial strains identification

ORI: software using long nanopore reads to identify bacteria present in a sample at the strain level
StrainFLAIR: STRAIN-level proFiLing using vArIation gRaph

General-purpose sequencing data manipulation

GASSST: long read mapper
Leon: short read compressor (now included in GATB-core)
Bloocoo: short read corrector
BCALM: Construct compacted de Bruijn graphs (unitigs)

Protein Structure

A_Purva: Contact Map Overlap solver
MD-Jeep: Distance Geometry solver
CSA: Comparative Structural Alignment

Workflow

SLICEE: parallel execution of bioinformatics workflows

Comparative Genomics

CASSIS: detection of rearrangement breakpoints
PLAST: intensive bank-to-bank sequence comparison
DRJBreakpointFinder: detection and precise localization of excision sites in proviral segments

VariantBam: Filtering and profiling of next-generational sequencing data using region-specific rules

Rahul Nayak — Thu, 04 Oct 2018 16:30:44 -0500

VariantBam is a tool to extract/count specific sets of sequencing reads from next-generational sequencing files. To save money, disk space and I/O, one may not want to store an entire BAM on disk. In many cases, it would be more efficient to store only those read-pairs or reads who intersect some region around the variant locations. Alternatively, if your scientific question is focused on only one aspect of the data (e.g. breakpoints), many reads can be removed without losing the information relevant to the problem.

Address of the bookmark: https://github.com/broadinstitute/VariantBam

RA at University of Delhi

Wed, 17 Jun 2015 20:35:35 -0500

Research Scientist Jobs opportunity in University of Delhi on temporary basis

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

jackalope: A swift, versatile phylogenomic and high-throughput sequencing simulator

Abhimanyu Singh — Fri, 26 Jul 2019 00:58:12 -0500

jackalope simply and efficiently simulates (i) variants from reference genomes and (ii) reads from both Illumina and Pacific Biosciences (PacBio) platforms. It can either read reference genomes from FASTA files or simulate new ones. Genomic variants can be simulated using summary statistics, phylogenies, Variant Call Format (VCF) files, and coalescent simulations—the latter of which can include selection, recombination, and demographic fluctuations. jackalope can simulate single, paired-end, or mate-pair Illumina reads, as well as reads from Pacific Biosciences These simulations include sequencing errors, mapping qualities, multiplexing, and optical/PCR duplicates. All outputs can be written to standard file formats.

A swift, versatile phylogenomic and high-throughput sequencing simulator https://jackalope.lucasnell.com

Address of the bookmark: https://github.com/lucasnell/jackalope

At what age did you gain passion in Bioinformatics?

Jit — Tue, 23 Jun 2015 10:39:06 -0500

Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?

genomics public data links !

Jit — Thu, 13 Feb 2020 00:20:00 -0600

List of publically available databases on google server.

More at https://software.broadinstitute.org/gatk/download/bundle

ftp://ftp.ncbi.nlm.nih.gov/snp/organisms/human_9606/VCF/GATK/.

ftp://ftp.broadinstitute.org/bundle/hg38/hg38bundle/

Address of the bookmark: https://console.cloud.google.com/storage/browser/genomics-public-data/resources/broad/hg38/v0?pli=1