Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Address of the bookmark: https://github.com/imgag/ClinCNV

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

https://github.com/CSB5/lofreq

http://csb5.github.io/lofreq/installation/

https://github.com/CSB5/lofreq/tree/master/dist

Address of the bookmark: http://csb5.github.io/lofreq/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

• Filters SNVs from any variant caller to remove false positives
• Calculates metrics based on BAM files and provides filtering not possible with other tools
• Fully user-configurable filtering (including which filters to use and their thresholds)
• Option to use filters identical to ICGC recommendations

FiNGS provides researchers with a tool to reproducibly filter somatic variants that is simple to both deploy and use, with filters and thresholds that are fully configurable by the user. It ingests and emits standard variant call format (VCF) files and will slot into existing sequencing pipelines. It allows users to develop and implement their own filtering strategies and simple sharing of these with others.

FiNGS reliably improves upon the precision of default variant caller outputs and performs better than other tools designed for the same task.

Address of the bookmark: https://github.com/cpwardell/FiNGS

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Variant calling and/or genotyping

• DiscoSNP++ and discoSnpRAD: Reference-free small variant discovery (SNPs and indels)
• MindTheGap: Detection and assembly of large insertion variants
• TakeABreak: reference-free inversion discovery tool
• SVJedi: Structural Variant genotyper with long read data
• SVJedi-graph: Structural Variant genotyper with long read data using a variation graph

Sequence assembly

• MinYS: reference-guided genome assembly in metagenomics data
• MTG-link: local assembly tool for linked-read data
• Minia: De novo short read assembler
• de-novo pipeline: de-novo assembly pipeline (error correction / contigs / scaffolding) for genomes and meta-genomes
• Mapsembler2: Targeted assembly (not maintained)

Managing k-mers & indexation

• findere: simple strategy for speeding up queries and for reducing false positive calls from any Approximate Membership Query data structure.
  • fimpera extends findere adding the abundance information.
• kmtricks: modular tool suite for counting kmers, and constructing Bloom filters or kmer matrices, for large collections of sequencing data.
• kmindex is a tool for indexing and querying sequencing samples. It is built on top of kmtricks.
• back to sequences: Find sequences (reads, unitigs, genes) related to a set of kmers in large datasets, in a matter of seconds.
• Backpack Quotient Filter: k-mer indexing data structure with abundance
• short read connector: Detect similar reads from potentially large read set
• DSK: Count K-mer in sequences

Pangenome graph manipulation

• Pancat: Pangenome Comparison and Analysis Toolkit
• GFAGraphs: a Python library to handle pangenome graph files in GFA format.

Comparative metagenomics with k-mers

• Simka and SimkaMin: Comparative metagenomics for large-scale datasets
• Comparead & Commet: comparison of metagenomic datasets

Species and bacterial strains identification

• ORI: software using long nanopore reads to identify bacteria present in a sample at the strain level
• StrainFLAIR: STRAIN-level proFiLing using vArIation gRaph

General-purpose sequencing data manipulation

• GASSST: long read mapper
• Leon: short read compressor (now included in GATB-core)
• Bloocoo: short read corrector
• BCALM: Construct compacted de Bruijn graphs (unitigs)

 Protein Structure

• A_Purva: Contact Map Overlap solver
• MD-Jeep: Distance Geometry solver
• CSA: Comparative Structural Alignment

Workflow

• SLICEE: parallel execution of bioinformatics workflows

Comparative Genomics

• CASSIS: detection of rearrangement breakpoints
• PLAST: intensive bank-to-bank sequence comparison
• DRJBreakpointFinder: detection and precise localization of excision sites in proviral segments

Address of the bookmark: https://github.com/broadinstitute/VariantBam

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83