<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31137?offset=1380</link>
	<atom:link href="https://bioinformaticsonline.com/related/31137?offset=1380" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22269/school-of-life-sciences-jawaharlal-nehru-university-vacancy-of-jrf-srf-ra-in-csir-funded-project</guid>
  <pubDate>Wed, 29 Apr 2015 21:26:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Project]]></title>
  <description><![CDATA[
<p>School of Life Sciences, Jawaharlal Nehru University has issued notification dated 27.04.2015 to fill the vacancy of JRF / SRF / RA in CSIR funded Projec entitled "Structural and functional characterization of serine biosynthetic pathway enzymes from entamoeba histolytica". It is good chance to get job with IITKGP and brighten your future. Learn eligibility criteria and apply on or before 08.05.2015.</p>

<p>Employer:	Jawaharlal Nehru University<br />Address:	Dr. S. Gourinath, Principal Investigator, School Of Life Sciences, Jawaharlal Nehru University, New Delhi-110067<br />Email:	not mentioned / provided for this job post<br />URL:	http://www.jnu.ac.in/Career/currentjobs.htm<br />Phone:	011 2674 2575<br />Skills:	not mentioned / required for this job post<br />Experience:	Experience in molecular biology, structural biology and bioinformatics is desired<br />Education:	M.Sc. in any field of life sciences.<br />Job Location:	New Delhi, Delhi, India   (View Jobs in New Delhi,   Jobs in Delhi,   Jobs in India)</p>

<p>Job Description: School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Projec</p>

<p>Name of the Post: JRF / SRF / RA</p>

<p>Salary: As per rules</p>

<p>Required Job Profile:</p>

<p>Candidate must possess M.Sc. in any field of life sciences.</p>

<p>Desired Job Profile:</p>

<p>Candidate having NET - CSIR or UGC and experience in molecular biology, structural biology and bioinformatics is desired and experience with publication is preferred.</p>

<p>How to apply:</p>

<p>Eligible and interested candidates should need to apply with complete details to the above mentioned address on or before 08.05.2015.</p>

<p>Refer to http://www.jnu.ac.in/Career/currentjobs.htm</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22287/research-fellows-at-aimscs-hyderabad</guid>
  <pubDate>Wed, 06 May 2015 06:23:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Fellows at AIMSCS, Hyderabad]]></title>
  <description><![CDATA[
<p>C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh<br />Advertisement No.: 5/2015</p>

<p>Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)</p>

<p>JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,</p>

<p>Pay Scale : Rs. 25,000</p>

<p>SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.</p>

<p>Pay Scale : Rs. 28,000*</p>

<p>No.of Post: 2</p>

<p>Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.</p>

<p>More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22403/ryan-e-mills-lab</guid>
  <pubDate>Tue, 26 May 2015 09:29:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Ryan E. Mills Lab]]></title>
  <description><![CDATA[
<p>Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that are not easily resolved through modern sequencing approaches and which may exhibit interesting mechanistic origins.</p>

<p>We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics. </p>

<p>More at http://millslab.ccmb.med.umich.edu/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>