TULIP currently consists of to Perl scripts, tulipseed.perl and tulipbulb.perl. These are very much intended as prototypes, and additional components and/or implementations are likely to follow. 
Tulipseed takes as input alignments files of long reads to sparse short seeds, and outputs a graph and scaffold structures. Tulipbulb adds long read sequencing data to these.

https://github.com/Generade-nl/TULIP

Address of the bookmark: https://github.com/Generade-nl/TULIP

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Bactopia can be split into two main parts: Bactopia Analysis Pipeline, and Bactopia Tools.

Bactopia Analysis Pipeline is the main per-isolate workflow in Bactopia. Built with Nextflow, input FASTQs (local or available from SRA/ENA) are put through numerous analyses including: quality control, assembly, annotation, minmer sketch queries, sequence typing, and more.

Bactopia Tools are a set a independent workflows fo

Address of the bookmark: https://github.com/bactopia/bactopia

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

This is where MeTAline comes in.

MeTAline is a reproducible workflow designed to simplify shotgun metagenomic analysis. It brings together important steps such as quality control, host-DNA removal, taxonomic profiling and functional analysis, using tools including Kraken2, MetaPhlAn4 and HUMAnN.

What makes it especially useful is its ability to handle large datasets while keeping analyses organized and reproducible. Built with Snakemake and supporting containerized environments, MeTAline can also be used on high-performance computing systems.

In simple terms, MeTAline helps researchers move from millions of confusing DNA fragments to a clearer picture of who is there, what they might be doing, and what the data could mean.

Sometimes, the biggest challenge in science isn't collecting more data — it's finding the story hidden inside it.

Read more at https://academic.oup.com/nargab/article/7/4/lqaf158/8340158?login=false

Address of the bookmark: https://sourceforge.net/projects/taxoblast/files/

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

Address of the bookmark: https://pgapx.ybzhao.com/

Documentation can be found at https://nanoporetech.github.io/katuali/.

Address of the bookmark: https://github.com/nanoporetech/katuali