<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31300?offset=1190</link>
	<atom:link href="https://bioinformaticsonline.com/related/31300?offset=1190" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5946/bioinformatics-tata-memorial-centre-navi-mumbai</guid>
  <pubDate>Mon, 28 Oct 2013 10:40:25 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics @ TATA MEMORIAL CENTRE, NAVI MUMBAI]]></title>
  <description><![CDATA[
<p>TATA MEMORIAL CENTRE<br />ADVANCED CENTRE FOR TREATMENT, RESEARCH AND EDUCATION IN CANCER<br />KHARGHAR, NAVI MUMBAI – 410210</p>

<p>No. ACTREC/Advt./ 72 /2013</p>

<p>WALK IN INTERVIEW</p>

<p>1. JRF*<br />Genome-wide RNAi screen with human pooled tyrosine kinase shRNA libraries in head and neck squamous call carcinoma (HNSCC) cell lines<br />DBT A/C No. 3071, Dr. Amit Dutt</p>

<p>2. JRF<br />IRB Project ACTREC Funds<br />Dr. Amit Dutt</p>

<p>3. RA<br />Defining the cancer genome of Head and Neck Squamous Cell Carcinoma (HNSCC) with SNP arrays and next generation sequencing technology<br />A/C No. 2895, Dr. Amit Dutt</p>

<p>Duration of the Project: One year from the date of appointment, or as and when project terminates.</p>

<p>Consolidated Salary: RA : Rs. 40,000/- p.m.<br />JRF* (DBT): Rs. 20,800/- p.m.<br />JRF: Rs. 16,000/- p.m.<br />Date &amp; Time: 6th November, 2013, at 10.00 a.m.</p>

<p>Venue: Conference Room</p>

<p>Minimum Qualifications and Experience:</p>

<p>RA: The ideal applicant should have a PhD in a relevant field. He/she should have a strong computational biology background, with demonstrated experience in coding using Perl, Python, Java or C++. He/she should be familiar with working in unix enviromnent, devising computational algorithms for data analysis, statistical data analysis in R and matlab and database programming using MySQL. Hands on experience in analyzing high throughput data would be an added advantage.</p>

<p>JRF* (DBT project): M.Sc. in Life Sciences or M.Tech in Biotechnology with good academic record (Minimum of 60% aggregate). Valid UGC-CSIR/DBT/ICMR JRF qualification and laboratory experience in molecular biology. Previous experience in molecular biology and animal tissue culture with high throughput platforms and ability to work with a large team would be desirable.</p>

<p>JRF (ACTREC project): M.Sc. in Life Sciences or M.Tech in Biotechnology with good academic record (Minimum of 60% aggregate). Minimum 2 yrs experience in molecular biology and animal tissue culture with high throughput platforms and ability to work with a large team is essential.</p>

<p>*M.Sc. degree obtained after a one year course will not be considered.</p>

<p>Candidates fulfilling above requirements should send their application by e-mail to<br />‘careers.duttlab@gmail.com. in the format given below so as to reach on or before<br />4th November, 2013.</p>

<p>Advertisement:</p>

<p>http://www.actrec.gov.in/data%20files/2013/AD-RA-JR-TECHN-6-NOV.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6012/project-junior-research-fellow-ccmb</guid>
  <pubDate>Fri, 01 Nov 2013 10:38:22 -0500</pubDate>
  <link></link>
  <title><![CDATA[Project Junior Research Fellow @ CCMB]]></title>
  <description><![CDATA[
<p>Temporary Project positions available purely on temporary basis - Oct/2013</p>

<p>1. Project Junior Research Fellow / Project Assistant</p>

<p>Last Date: 11th Nov 2013</p>

<p>Qualification B.Tech (Comp. Sci.), B.Tech/M.Tech (Bioinformatics), MCA,  M.Sc. (Mathematics/Statistics)</p>

<p>Desirable Qualifications: Programming in FORTRAN/ C /PERL, Web application technologies</p>

<p>Upper Age limit 28</p>

<p>Rs.12000 / Rs.16000 (as sanctioned by the funding agency)</p>

<p>General terms and conditions:</p>

<p>    Positions are purely temporary and co-terminus with the project.</p>

<p>    HRDG (CSIR) prevailing guidelines are applicable these positions.</p>

<p>    All categories of applicants are required to submit online application.</p>

<p>    Enhancement of stipend to Project JRF to Project SRF will be with the due recommendation of Principal Investigator and approval of the Director on the evaluation of the 3 member Standing Committee consisting of Chairperson at the level of Chief Scientist, Coordinator of the JRFs/RAs/PDFs and the Principal Investigator of the Project.</p>

<p>    The age relaxation as per HRDG (CSIR) norms: SC/ST/OBC/Women/Physically Handicapped persons – five years.</p>

<p>    The Stipend normally be fixed at Rs.22000/- for Research Associates/Post Doc. Fellows. However, a selected RA/PDF may be placed in the higher start of stipend if there is ample justification and such recommendation is made by the Selection Committee. Based on the recommendation with justification by the PI and approval of the Director, person getting stipend at lower rate may be elevated to higher rate subject to availability of the funds in the project.</p>

<p>    Recruitment will be based on initial screening based on qualifications and experience criteria and also based on suitability of the candidates to the nature of research project. This screening will be followed by written test followed / interview. After completing this process, candidates will be shortlisted and appointed in specific project subjects as and when appropriate positions become available. The pool of selected candidates will be valid for six months.</p>

<p>    Remunerations indicate are maximum admissible and will depend upon the availability of funds and subject to conditions applicable to projects from different funding agencies at the time of recruitment.</p>

<p>Apply : http://www.ccmb.res.in/positions/projects/temp_positions.php</p>

<p>Form download : http://www.ccmb.res.in/positions/projects/oct-2013/pdf_download.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6233/edwards-lab</guid>
  <pubDate>Sun, 10 Nov 2013 15:07:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[Edwards Lab]]></title>
  <description><![CDATA[
<p>We study the evolutionary biology of birds and relatives, combining field, museum and genomics approaches to understand the basis of avian diversity, evolution and behavior. Our guiding approaches include population genetics, which provides a quantitative framework for studying speciation, geographic variation and genome evolution; systematics, which acknowledges that the focal species of any study has relatives that are behaviorally and ecologically no less interesting; and natural history, which gives meaning to the genes and genomic patterns we study.</p>

<p>Lab page: http://www.oeb.harvard.edu/faculty/edwards/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6559/ai-cadd-project-kerela-university</guid>
  <pubDate>Tue, 19 Nov 2013 17:48:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Ai-CADD Project @ Kerela University]]></title>
  <description><![CDATA[
<p>Applications are invited for the following Positions in the AiCADD project funded by MHRD Govt of India</p>

<p>Last Date for Submitting Application: 25th November 2013</p>

<p>1. Senior Scientist: (01 position)<br />Pay Scale: Rs.40, 000/-<br />Qualifications:  PhD/ Post Doctoral with Experience in CADD</p>

<p>2. Junior Scientist (10 positions)<br />Pay Scale: Rs. 22,000/-<br />Qualifications: MPhil / Masters Degree in Bioinformatics / Computational Biology / CADD / Ayurveda</p>

<p>3. Technical Assistant (01+01 positions)<br />Pay Scale: Rs.12,000/-<br />Qualifications: 1. BSc Computer Science/ MCA<br />Qualifications: 2. MSc Biotechnology / MSc Microbiology </p>

<p>4. Programmer (01 position)<br />Pay Scale: Rs.20,000/-<br />Qualifications: MSc Computer Science/ MCA / B Tech (Experience in MATLAB, C, C++) Industrial experience is desirable</p>

<p>5. Teaching Assistant (03 positions)<br />Pay Scale: Rs.10,000/-<br />Qualifications: MSc in Bioinformatics </p>

<p>6. Administration Assistant (02 positions)<br />Pay Scale: Rs.8,000/-<br />Qualifications: Degree + PGDCA</p>

<p>The Selection process comprises of written test and interview. Positions are purely temporary (initially for the period of one year) and co-terminus with the project. For more details mail to: cbi.uok [at] gmail.com</p>

<p>More detail @ https://sites.google.com/site/centreforbioinformatics/announcements/applicationsinvitedforapplicationforai-caddproject</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6577/scientist-b-vector-control-research-centre</guid>
  <pubDate>Tue, 19 Nov 2013 21:19:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist-B @ VECTOR CONTROL RESEARCH CENTRE]]></title>
  <description><![CDATA[
<p>VECTOR CONTROL RESEARCH CENTRE<br />(Indian Council of Medical Research)<br />Indira Nagar Medical Complex<br />Puducherry-605006</p>

<p>WALK-IN-INTERVIEW</p>

<p>The following vacancies shall be filled purely on adhoc basis under Non-Institutional adhoc project “Bioinformatics in ICMR Institutes” funded by Indian Council of Medical Research at Vector Control Research Centre, Puducherry, to be renewed annually and filled through Walk-in-Interview as indicated below. Candidates who wish to appear for the Walk-in-Interview can download the application format given in the website of Vector Control Research Centre (www.vcrc.res.in). Duly filled in application along with attested copies of certificate should be submitted at time of interview.</p>

<p>Date &amp; Time : 05.12.2013 at 9.00 AM – Scientist-C (Non-Medical)</p>

<p>05.12.2013 at 1.30 PM – Scientist-B (Non-Medical)<br />06.12.2013 at 9.00 AM – Technical Assistant (Research Assistant)<br />06.12.2013 at 1.30 PM – Multi Tasking Staff (General)</p>

<p>Place : Vector Control Research Centre, Puducherry</p>

<p>Project entitled : Biomedical Informatics Centres of ICMR</p>

<p>1. Scientist - C (Non-Medical) Number of post – ONE</p>

<p>Essential qualification</p>

<p>B.E./ B. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University with 6 years experience in the relevant field  OR</p>

<p>First class Master’s Degree and Ph.D. Degree in Bioinformatics/ Computational Biology from a recognized University OR</p>

<p>First class Master’s Degree in Bioinformatics/ Computational Biology from a recognized University with 4 years R &amp; D experience in the related subjects as mentioned above OR</p>

<p>Second class Master’s Degree + Ph.D. in Bioinformatics/ Computational Biology from a recognized University with 4 years research experience in bio-medical subjects</p>

<p>Age: Not exceeding 40 years Consolidated Salary – Rs.39,960/- p.m. + HRA as<br />admissible </p>

<p>Desirable qualification (i) Post-doctorate in Bioinformatics/ Computational Biology or M.E. / M. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University for candidates with First Class relevant degree.</p>

<p>(ii) Additional post-doctoral research / teaching experience in Bioinformatics/Computational Biology in recognized Institute(s).</p>

<p>(iii) Knowledge of computer applications or data management</p>

<p>Job requirements i) To apply Bioinformatics / Computational Biology tools in understanding interactions between vectors and parasites/ pathogens and target based development of drug / insecticides.</p>

<p>ii) To assist the investigators to carry out genomic studies on parasites/pathogens/vectors of vector borne diseases</p>

<p>Advertisement: http://vcrc.res.in/Adv_Bio13.pdf</p>
]]></description>
</item>

</channel>
</rss>