➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

WALK-IN-INTERVIEW

The following vacancies shall be filled purely on adhoc basis under Non-Institutional adhoc project “Bioinformatics in ICMR Institutes” funded by Indian Council of Medical Research at Vector Control Research Centre, Puducherry, to be renewed annually and filled through Walk-in-Interview as indicated below. Candidates who wish to appear for the Walk-in-Interview can download the application format given in the website of Vector Control Research Centre (www.vcrc.res.in). Duly filled in application along with attested copies of certificate should be submitted at time of interview.

Date & Time : 05.12.2013 at 9.00 AM – Scientist-C (Non-Medical)

05.12.2013 at 1.30 PM – Scientist-B (Non-Medical)
06.12.2013 at 9.00 AM – Technical Assistant (Research Assistant)
06.12.2013 at 1.30 PM – Multi Tasking Staff (General)

Place : Vector Control Research Centre, Puducherry

Project entitled : Biomedical Informatics Centres of ICMR

1. Scientist - C (Non-Medical) Number of post – ONE

Essential qualification

B.E./ B. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University with 6 years experience in the relevant field OR

First class Master’s Degree and Ph.D. Degree in Bioinformatics/ Computational Biology from a recognized University OR

First class Master’s Degree in Bioinformatics/ Computational Biology from a recognized University with 4 years R & D experience in the related subjects as mentioned above OR

Second class Master’s Degree + Ph.D. in Bioinformatics/ Computational Biology from a recognized University with 4 years research experience in bio-medical subjects

Age: Not exceeding 40 years Consolidated Salary – Rs.39,960/- p.m. + HRA as
admissible

Desirable qualification (i) Post-doctorate in Bioinformatics/ Computational Biology or M.E. / M. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University for candidates with First Class relevant degree.

(ii) Additional post-doctoral research / teaching experience in Bioinformatics/Computational Biology in recognized Institute(s).

(iii) Knowledge of computer applications or data management

Job requirements i) To apply Bioinformatics / Computational Biology tools in understanding interactions between vectors and parasites/ pathogens and target based development of drug / insecticides.

ii) To assist the investigators to carry out genomic studies on parasites/pathogens/vectors of vector borne diseases

Advertisement: http://vcrc.res.in/Adv_Bio13.pdf

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

Duration: 1 year

Funding Source: Institutional
Salary on grant: B2 (€ 22.000/year gross)
Contact Person (Referent): Tommaso Mazza
Ref. E-Mail: t.mazza@css-mendel.it
Tel: +39 06 44160526
Fax: +39 06 44160548

Job Description: The bioinformatics unit at IRCCS Casa Sollievo della Sofferenza - Mendel laboratory in Rome is looking for one young PhD bioinformatician with specific experience and/or interest in the analysis of transcriptomic data.

The candidate will be mainly in charge of developing research on a range of hot applications and projects, dealing with microarrays, RNA-Seq and miRNA-Seq data. Main activities will be: (i) data analysis (short-reads mapping, variants call and annotation, functional enrichment analysis of gene expression data); (ii) networks analysis and simulation (artificial knockout, redundancy and lethality analysis, gene set essentiality); (iii) developing of ad-hoc software solutions/routines on clusters of CPUs and GPUs.

The correct cultural background (training in Biology / Computer Science / Statistics or a mix of the three) and a strong interest in working with high throughput data analysis will be considered at the same level of specific experience in the above-mentioned fields.
Knowledge of molecular modeling and simulation and one of these languages: python, perl, R, Java, C++, C# is a golden plus. Good knowledge of Scientific English will be positively evaluated for this position, together with good presentation and teamwork skills.

A CV with one professional reference, details on educational background and of the biological and/or bioinformatic and/or data analysis skills and experience should be sent by email for a preliminary selection to: Tommaso Mazza, CSS-Mendel: t.mazza@css-mendel.it

Context
Casa Sollievo della Sofferenza is an Institute for hospitalization, care, and scientific research located in San Giovanni Rotondo, Italy. It integrates clinical assistance (with inpatient and outpatient facilities) and research. It has an affiliate institute, CSS-Mendel, located in Rome. Between the two sites, it employs over 100 researchers who focus on genetics. The Center is equipped with state of the art genomics technology (SOLiD 5500XL next generation sequencer, Illumina MiSeq, Affymetrix/Agilent microarray platforms, etc) as well as a dedicated high performance computing facility, a non-conventional workstation of GPUs and a short- and long-term storage disk.

Applications
Candidates should send:
• a cover letter explaining the role they would like to undertake within the Center, even if it is not listed in this job adv, stating clearly why they would be a good fit to the proposed role, and what they would bring to the Center in terms of expertise, ideas, talent;
• a CV including a list of publications;
• List of referees;

More at http://www.css-mendel.it/

Address of the bookmark: http://www.fishbrowser.org/software/P_RNA_scaffolder/#

1. Work to establish improved quantitative experimental assays (such as microarrays or differential in-gel electrophoresis) and
2. Development of modern computational methods (such as hierarchical probabilistic models or integration of heterogeneous data sources)

Lab page @ http://bioinf.boku.ac.at/

Address of the bookmark: http://chmille4.github.io/Scribl/

Please add ur links/bookmarks in comment section.

Address of the bookmark: http://physicsdatabase.com/free-math-books/

download swgis v2.0

Address of the bookmark: http://eugi.bi.up.ac.za/eugi_download_swgis.php

Address of the bookmark: http://bioinformatics.oxfordjournals.org/content/23/14/1713.full