BOL: Related items

Human Genome Meeting 2014, Geneva, Switzerland

Fri, 20 Sep 2013 12:36:44 -0500

The spectacular advances of the last few years resulted in the rapid analysis of the genome sequence of each individual. The biomedical world is now faced with the enormous challenges of assigning pathogenicity to each genomic variant, the functional analysis of the genome of each individual, and the accurate and detailed phenotypic characterization. Advances in these challenges are likely to fundamentally change the medical practice in a global scale.

This 2014 HUGO Meeting in Geneva will be a Forum for discussions on innovative approaches, and proposals to tackle the anticipated challenges.

Time : 27 April 2014 - 30 April 2014

For enquiries, please email hugo2014@mci-group.com or visit www.hugo-international.org

More at http://www.hgm2014-geneva.org/

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Molecular and Computational Biology Research School

Fri, 20 Sep 2013 09:01:18 -0500

The ambition of the Molecular and Computational Biology Research School (MCB) is to create an attractive and stimulating training environment for PhD students in molecular and computational biology, both to better serve the needs for relevant training in the field, and to stimulate crossdiscipline developments in the research of the parties.

http://www.uib.no/rs/mcb

GFinisher: a new strategy to refine and finish bacterial genome assemblies

Jit — Thu, 26 Jul 2018 09:31:55 -0500

GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.

java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory

Address of the bookmark: http://gfinisher.sourceforge.net

Murray Cox's Genomicus Lab

Thu, 26 Sep 2013 16:42:42 -0500

This group interested in modeling genome dynamics in following topics:

---how genetic variation is distributed within and between individuals,
---determining how this diversity changes over evolutionary time.

Hence, Cox group work at the interface between biology, statistics and computer science to address questions of outstanding biological importance through intrepretation of large genetic datasets.

Profile:
Associate Professor Murray Cox,
Inaugural Rutherford Fellow of the Royal Society of New Zealand, Principal Investigator in the BioProtection Research Center and Associate Investigator in the Allan Wilson Center for Molecular Ecology and Evolution
Email : m.p.cox@massey.ac.nz
Webpage: http://massey.genomicus.com/index.html

MITOS: improved de novo metazoan mitochondrial genome annotation

Jit — Fri, 26 Oct 2018 08:25:39 -0500

Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.

Address of the bookmark: http://mitos.bioinf.uni-leipzig.de/index.py

04- Informatics Approach to Cancer - Interview with Dr. Joel Saltz

Mon, 07 Oct 2013 14:35:43 -0500

For additional information visit http://www.cancerquest.org/joel-saltz-interview. Dr. Joel Saltz is a Professor in the Departments of Pathology, Biostatistics and Bioinformatics, and Mathematics and Computer Science at Emory University. Dr. Saltz's research on bioinformatics spans several disciplines. One project involves applying computer analysis to medical imaging to yield better results for patients. As an example, a computer program may able to help doctors detect small cancers in a CT scan or mammogram. In this interview segment, Dr. Saltz discusses the informatics approach to cancer. To learn more about cancer and watch additional interviews, please visit the CancerQuest website at http://www.cancerquest.org.

ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.

Neel — Fri, 09 Nov 2018 13:50:04 -0600

ASCIIGenome is a genome browser based on command line interface and designed for running from console terminals.

Since ASCIIGenome does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like IGV.

Documentation is at readthedocs/asciigenome.

Address of the bookmark: https://github.com/dariober/ASCIIGenome

Evolution and Cancer

Fri, 27 Sep 2013 11:28:49 -0500

Air date: Wednesday, January 04, 2012, 3:00:00 PM Time displayed is Eastern Time, Washington DC Local Category: Wednesday Afternoon Lectures Description: There is a broad consensus that cancer is the result of somatic cells having serially gained, by a series of mutations, the ability to grow independently, to recruit resources from the circulation and the stroma, to invade local tissues, and to found anatomically distant metastases, ultimately killing the host. From the point of view of the cancer-causing somatic cell population, this is evolution driven by mutation and selection. Genomics has resulted in a parallel consensus that the central functions of all eukaryotes are highly conserved, not only at the level of individual protein functions, but also complex biological pathways and systems. These ideas motivated a comparison between results of molecular genetic studies of experimental evolution in yeast and the molecular genetic phenomena associated with tumorigenesis and tumor progression. We find some very striking similarities, including recurring genomic rearrangements, alterations of the regulation of specific growth-promoting genes, population-genetic features that affect the fitness trajectories of growth rate variants in evolving populations, and physiological and metabolic similarities derived from the conservation of the basic plan of growth and cell multiplication among all eukaryotes. It is hoped that some of the insights from yeast will aid the interpretation of sequence changes found in tumors, especially in the urgent necessity to distinguish 'driver' from 'passenger' mutations." David Botstein's fundamental contributions to modern genetics include the development of genetic methods for understanding biological functions and the discovery of the functions of many yeast and bacterial genes. In 1980, Botstein and three colleagues proposed a method for mapping human genes that laid the groundwork for the Human Genome Project. The basic principle of the mapping scheme was to develop, by recombinant DNA techniques, random single-copy DNA probes capable of detecting DNA sequence polymorphisms when hybridized to restriction digests, or specific fragments, of an individual's DNA. The method was used in subsequent years to identify several human disease genes, such as Huntington's and BRCA1. Variations of this method enabled the sequencing phase of the Human Genome Project. In the 1990s Botstein, having moved to Stanford University School of Medicine, collaborated with Patrick O. Brown of Stanford in exploiting DNA microarrays to study genome-wide gene expression patterns in yeast and in human cancers. This required developing a new statistical method and graphical interface, widely used today to interpret genomic data. Botstein also has helped to create, with Michael Ashburner and Gerald Rubin, a bioinformatics initiative to unify the representation of gene and gene product attributes across all species, called Gene Ontology. He graduated from Harvard College and earned his doctorate from the University of Michigan. He worked at Massachusetts Institute of Technology from 1967 to 1988; served as vice president for science at Genentech from 1988 to 1990; chaired the Department of Genetics at the Stanford University School of Medicine from 1990 to 2003; and joined the Princeton University faculty in 2003. He has sat on numerous editorial boards and was the founding editor of Molecular Biology of the Cell. Among recent major awards, Bostein won the Peter Gruber Foundation Prize in Genetics in 2003, the Apple Science Innovator Award in 2008, and the Albany Medical Center Prize in 2010. The NIH Wednesday Afternoon Lecture Series includes weekly scientific talks by some of the top researchers in the biomedical sciences worldwide. For more information, visit: The NIH Director's Wednesday Afternoon Lecture Series Author: Dr. David Botstein, Princeton University Runtime: 00:59:58 Permanent link: http://videocast.nih.gov/launch.asp?17046

genoPlotR - plot gene and genome maps project!

Abhimanyu Singh — Wed, 12 Dec 2018 08:33:41 -0600

genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.

Features

Linear representation of several segments of DNA
Comparisons represented by areas between the segments (like Artemis, for example)
Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files
Plot several subsegments of the same segment on the same line, separated by a //
Automatic or manual placement of the segments on the plot
Add annotations to all the lines
Create smart, automatic annotations for genomes, based on gene names
Add a user-generated tree
Add a global scale or a scale to each line
Use user-defined graphical functions to represent genes

Address of the bookmark: http://genoplotr.r-forge.r-project.org/