RNAs, especially non-coding RNAs (such as microRNA, long ncRNAs) are recently identified to be very abundant in mammalian organisms and play some key roles in gene expression regulation, gene silencing, and also implicated in disease progression, stem cell pluripotency etc. Current research activities of our lab include analysis of expression pattern of ncRNAs by microarray and next-gen sequencing data and understanding the role of miRNAs or other regulatory RNAs in various diseases, especially cancer and validation by reporter assays (renilla/luciferase) and other experimental tools.

More @ http://vvekslab.in/index.html

Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence. 

Address of the bookmark: https://sourceforge.net/projects/metassembler/?source=directory

Phone No. 0495 2731 410

WALK -IN- TEST CUM INTERVIEW
Walk- in- Test cum Interview (based on test) for the selection of Research Associate (Bioinformatics) & Bioinformatic Trainees under the scheme ‘Distributed Information Sub Centre- DISC’ will be held at this Institute as per details indicated below.

Research Associate
Date of Interview : 21 -01-2014 at 10.00 A.M
Qualifications :
a) Essential: Doctorate degree in Bioinformatics or Biotechnology/Life Sciences/Biochemistry with expertise in Bioinformatics as evidenced by publications.
OR Three years research experience after MVSc/MPharm/ME/MTech with Bioinformatics Specialization.
b Desirable: Experience in handling NGS data Programming skills in Python/Bioperl
Emoluments : Rs:22000/- per month + HRA (higher pay upto Rs.24000/- can be paid depending on the qualifications and experience.
Upper age limit : 40 years for Men & 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)
Duration of Project : Till the closure of the project.

General Terms and conditions
1. The above positions are purely on temporary basis and is co-terminus with the closure of the project. There is no provision of re-employment after termination of project.
The selected candidate will not have any right for claiming pay scale or absorption
against any regular post being vacant on a later date at this Institute.
2 . No TA/DA will be paid for attending the Interview.
3. Canvassing in any form will lead to cancellation of candidate.
4. The decision of Director, IISR would be final and binding in all aspects.
5. Candidates will not be permitted to enter the Examination Hall after 10.00 A.M.
6. Candidates who secure the minimum marks prescribed by the Institute in written test only will be eligible for calling for the interview. The number of candidates to be called for the interview will be decided by the Director of the Institute.
7 Those who do not possess original Degree/PG certificate or Provisional certificate will not be allowed to attend the Test/Interview.

Note: All relevant certificates (in original) and bio data, No objection certificate in case he/she is employed elsewhere and experience certificate in original (if any) need to be produced at the time of interview.
Advertisement: http://spicebioinfo.res.in/downloads/DISC-Website.pdf

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Salary: £27,854 - £29,541, with progression to £36,298

You will perform cutting edge computational biology within the Faculty of Medical Sciences, with a particular focus on the Northern Institute for Cancer Research (NICR), and contribute to the delivery of Faculty wide programmes of training, analytical services and skill transfer between Faculty Institutes.

You will have a relevant first degree or equivalent qualifications and/or experience in a relevant scientific/technical role, together with previous specialist experience at a senior level in bioinformatics. A PhD is desirable.

This position is part of the Bioinformatics Support Unit but physically located for the majority of the time in the NICR buildings.

Tenable for three years.

Informal enquiries to unit head Dr Simon Cockell: 0191 222 7253; simon.cockell@ncl.ac.uk

For more information visit @ https://www15.i-grasp.com/fe/tpl_newcastle02.asp?s=4A515F4E5A565B1A&jobid=50667,2552984041&key=70203469&c=725434237887&pagestamp=sepghtjhowdqpsxuyn

You can also find several other jobs @http://bsu.ncl.ac.uk/support/recruitment/

java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory

Address of the bookmark: http://gfinisher.sourceforge.net

Functioning of efflux systems in Gram-negative bacteria
Determinants of the compound-efflux system interactions
Action of inhibitors on efflux systems
Structural and dynamical features of the efflux systems

TatA
Assembly of the TatA system
Study of the dynamical features of the charge zipper

Methods
Setup of a kinetic Monte Carlo (KMC) scheme to study the flux of antibiotics through porins and efflux systems
Setup of protocol to integrate MD results in a ligand-based approach

Viral inhibitors
Interactions of selected compounds with RNA-dependent RNA polymerases (RdRps) of HCV and BVDV
Assessment of the role of mutations in RdRps
Antimicrobial peptides

Interactions of antimicrobial peptides with membranes: structure and dynamics
Interactions between antimicrobial peptides in the presence of different membranes
Protein-protein interactions
Effects of mutations

Lab Page
http://www.dsf.unica.it/~paolo/Site/Home.html

Address of the bookmark: http://mitos.bioinf.uni-leipzig.de/index.py