BOL: Related items

Research Project Posts for CSIR Project, Delhi

Tue, 27 Aug 2013 04:31:41 -0500

Positions Open For Temporary Research Project Posts for CSIR Project, Delhi
CSIR is looking for bright young candidates to get involved in building algorithms and platforms for large biological data analyses in the areas of comparative genomics, computational workflows, disease association studies, simulating virtual organelles, etc. Anyone who fulfills the eligibility criteria mentioned below may appear for a walk-in interview on 3rd September 2013 at CSIR Headquarters, Anusandhan Bhawan, 2 Rafi Marg, Delhi – 110001.
you can go to link for details or download PDF

http://www.csir.res.in/External/Heads/aboutcsir/announcements/ProjectPost_130813.pdf

MUMmer4: A fast and versatile genome alignment system

Jit — Sat, 03 Feb 2018 04:59:17 -0600

MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the nucmer program in MUMmer4 is easily able to handle alignments of large genomes;

Address of the bookmark: https://mummer4.github.io/

Bioinformatics Algorithm Demonstrations and Tutorials

Jitendra Narayan — Thu, 29 Aug 2013 09:23:51 -0500

Abstract

This project presents demonstrations of selected computer science algorithms important in bioinformatics, implemented in the spreadsheet program Microsoft Excel. Spreadsheets provide an interesting platform for demonstration of algorithms, since various steps of the calculations can be exposed in a manner that is easily comprehensible to users with little programming experience. The algorithms demonstrated include two approaches to approximate string matching (dynamic programming and Shift-AND numeric approximate matching), Hierarchical Clustering (used in phylogenetic studies and microarray analysis of gene expression), a Naive Bayes Classifier for simulated microarray gene expression data, and a simple Neural Network. These demonstrations are designed to serve as instructional aids in bioinformatics courses.

Tutorial @ http://www.cybertory.org/downloads/bae/BioinformaticsAlgorithmsInExcel.zip

One of the best resource for online bioinformatics learning is https://stepic.org/Bioinformatics-Algorithms-2 Enjoy the online learning.

Reference : cybertory

" Please add your favourite bioinformatics algorithms and tutorial links below in the comment section, for the benefit of bioinformatics and computational biology community ".

Address of the bookmark: http://www.cybertory.org/downloads/bae/BioinformaticsAlgorithmsExcelDoc.pdf

Metassembler: merging and optimizing de novo genome assemblies

Rahul Nayak — Tue, 08 May 2018 04:52:33 -0500

Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.

Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.

Address of the bookmark: https://sourceforge.net/projects/metassembler/?source=directory

4273π: Bioinformatics education on low cost ARM hardware

Jitendra Narayan — Mon, 02 Sep 2013 07:02:43 -0500

Are you teaching bioinformatics at universities and found it complicated by typical computer classroom settings. As well as running software locally and online, students should gain experience of systems administration. Hmm don't worry there is one new OS for the rescue. 4273π, an operating system image for Raspberry Pi based on Raspbian Linux. It provides an attractive, general-purpose computing environment, within which the course 4273π Bioinformatics for Biologists is embedded.

Though far slower than current desktop and laptop computers, the Raspberry Pi is notably faster than the Cray 1 supercomputer, a marvel of computer speed in its day. The Raspberry Pi approach includes all the benefits of the laptop approach, above, but at lower cost. In addition, the Raspberry Pi is a new and exciting computer system, which in itself can add interest to the course.

As the Raspbian operating system, Raspberry Pi firmware and hardware and 4273π Bioinformatics for Biologists teaching material develop, further releases of 4273π will be made available. It is anticipated that there will be a minimum of two releases per year during the next four years.

4273π is a means to teach bioinformatics, including systems administration tasks, to undergraduates at low cost.

Descriptive paper @ http://www.biomedcentral.com/1471-2105/14/243

Image source: BMC Bioinformatics

PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.

Surabhi Chaudhary — Mon, 11 Jun 2018 03:08:26 -0500

We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler. http://derisilab.ucsf.edu/software/price/

Address of the bookmark: http://derisilab.ucsf.edu/software/price/

Huber Lab

Mon, 09 Sep 2013 21:57:03 -0500

The Huber group develops computational and statistical methods to design and analyse novel experimental approaches in genetics and cell biology.

Future projects and goals

Large-scale systematic maps of gene-gene and gene-environment interactions by automated phenotyping, using image analysis, machine learning, sparse model building and causal inference.
DNA-, RNA- and ChIP-Seq and their applications to gene expression regulation: statistical and computational foundations.
Cancer genomics, genomes as biomarkers, cancer phylogeny.
Image analysis for systems biology: measuring the dynamics of cell cycle and of cell migration of individual cells under normal conditions and many different perturbations (RNAi, drugs).

More @ http://www.embl.de/research/units/genome_biology/huber/index.html

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr