<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31345?offset=560</link>
	<atom:link href="https://bioinformaticsonline.com/related/31345?offset=560" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4409/huber-lab</guid>
  <pubDate>Mon, 09 Sep 2013 21:57:03 -0500</pubDate>
  <link></link>
  <title><![CDATA[Huber Lab]]></title>
  <description><![CDATA[
<p>The Huber group develops computational and statistical methods to design and analyse novel experimental approaches in genetics and cell biology. </p>

<p>Future projects and goals</p>

<p>Large-scale systematic maps of gene-gene and gene-environment interactions by automated phenotyping, using image analysis, machine learning, sparse model building and causal inference.<br />DNA-, RNA- and ChIP-Seq and their applications to gene expression regulation: statistical and computational foundations.<br />Cancer genomics, genomes as biomarkers, cancer phylogeny.<br />Image analysis for systems biology: measuring the dynamics of cell cycle and of cell migration of individual cells under normal conditions and many different perturbations (RNAi, drugs).</p>

<p>More @ http://www.embl.de/research/units/genome_biology/huber/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4456/asst-prof-in-bioinformatics-at-jaipur-national-university</guid>
  <pubDate>Thu, 12 Sep 2013 07:18:02 -0500</pubDate>
  <link></link>
  <title><![CDATA[Asst. PROF IN BIOINFORMATICS at JAIPUR NATIONAL UNIVERSITY]]></title>
  <description><![CDATA[
<p>JAIPUR NATIONAL UNIVERSITY, SCHOOL OF LIFE SCIENCES (SIILAS CAMPUS) URGENTLY REQUIRES</p>

<p>Asst. PROF IN BIOINFORMATICS.</p>

<p>QUALIFICATION: AS PER UGC</p>

<p>DESIRABLE: 1 YEAR EXPERIENCE IN ACADEMICS</p>

<p>CONTACT immediately</p>

<p>Prof D.S.Bhatia<br />Director<br />9351288070</p>

<p>Last date within 7 days of the publication.</p>

<p>Find more @ http://jnujaipur.ac.in/downloads/AdvtDec2012.jpg</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6715/research-associate-school-of-computational-and-integrative-sciences-under-jawaharlal-nehru-university</guid>
  <pubDate>Fri, 22 Nov 2013 19:06:44 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Associate@ School of Computational and Integrative Sciences under Jawaharlal Nehru University]]></title>
  <description><![CDATA[
<p>School of Computational and Integrative Sciences under Jawaharlal Nehru University, New Delhi invited applications for filling up 4 posts of Research Associates (RA) and Junior Research Fellow (JRF) (2 posts each)  purely on temporary basis, liable to be terminated at any time without prior notice or ceased/withdrawn by the funding agency. The vacancies are for a Department of Biotechnology, Government of India funded project entitled "Computational Core for Plant Metabolomics" (Project ID: 632) being administered by Prof Indira Ghosh. Interested candidates should send their applications till 13 December 2013.<br />Important Dates<br />Last Date for receipt of applications: 13 December 2013<br />Vacancy Details<br />Total Vacancies: 4 posts<br />Type of recruitment: Temporary<br />Sl. No.: 01<br />Name of the Post: Research Associate<br />No of Posts: 1 post<br />Remuneration: Rs.  23000 + 30%<br />Qualifications: PhD in Bioinformatics / computational biology / Biophysics / Physical Chemistry / Computer Science. Computational experience, proven by paper published, is a necessary qualification.<br /> Sl. No.: 02<br />Name of the Post: Research Associate<br />No of Posts: 1 post<br />Remuneration: Rs. 23000 + 30%<br />Qualifications: PhD in Computational Biology / Bioinformatics &amp; related subjects. Computational experience, proven by paper published, is a necessary qualification.<br />Sl. No.: 03<br />Name of the Post: Junior Research Fellow<br />No of Posts: 1 post<br />Remuneration: Rs. 12000 + 30%<br />Qualifications: M. Sc. / B. Tech. preferably in Computational Biology /Bioinformatics and related fields with experience in Website designing &amp; maintenance of Database.<br />Sl. No.: 04<br />Name of the Post: Junior Research Fellow<br />No of Posts: 1 post<br />Remuneration: Rs.  12000 + 30%<br />Qualifications: M. Sc. / MCA / B. Tech. preferably in Computational Biology / Computer science with experience in Programming in Java / Python, C++ etc &amp; designing of Database.<br />Selection Procedure: Selection will be done on the basis of candidates’ performance in the Interview.  <br />Candidates short-listed / selected for Interview will be informed through email only.<br />How to Apply: Interested eligible candidates should send their applications, in the prescribed format, along with their current CV by post to “Prof Indira Ghosh, Project Investigator,  Hall#6, School of Computational and Integrative Sciences,  Jawaharlal Nehru University,  New Delhi-110 067” so as to reach the concerned authority by 13 December 2013.<br />Name of the post applied for’ must be superscripted on the envelope containing the application.<br />NOTE: For the post of Research Associates, only those candidates who have submitted thesis are eligible to apply. However, salary will be provided as per DBT / DST guidelines (i.e. candidates who have qualified NET /BET / BINC will have higher pay scale).<br />Candidates interested to register for PhD may not apply for JRF.<br />More @ http://www.jnu.ac.in/Career/currentjobs.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</guid>
	<pubDate>Tue, 30 Oct 2018 10:49:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</link>
	<title><![CDATA[Synima: a Synteny imaging tool for annotated genome assemblies]]></title>
	<description><![CDATA[<p><span>Synima written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima &ndash; and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from&nbsp;</span><a href="https://github.com/rhysf/Synima" target="_blank">https://github.com/rhysf/Synima</a><span>&nbsp;under the MIT License.</span></p><p>Address of the bookmark: <a href="https://github.com/rhysf/Synima" rel="nofollow">https://github.com/rhysf/Synima</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4653/human-genome-meeting-2014-geneva-switzerland</guid>
  <pubDate>Fri, 20 Sep 2013 12:36:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[Human Genome Meeting 2014, Geneva, Switzerland]]></title>
  <description><![CDATA[
<p>The spectacular advances of the last few years resulted in the rapid analysis of the genome sequence of each individual. The biomedical world is now faced with the enormous challenges of assigning pathogenicity to each genomic variant, the functional analysis of the genome of each individual, and the accurate and detailed phenotypic characterization. Advances in these challenges are likely to fundamentally change the medical practice in a global scale.</p>

<p>This 2014 HUGO Meeting in Geneva will be a Forum for discussions on innovative approaches, and proposals to tackle the anticipated challenges.</p>

<p>Time : 27 April 2014 - 30 April 2014 </p>

<p>For enquiries, please email hugo2014@mci-group.com or visit www.hugo-international.org</p>

<p>More at http://www.hgm2014-geneva.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38208/anitools-web-a-web-tool-for-fast-genome-comparison-within-multiple-bacterial-strains</guid>
	<pubDate>Wed, 14 Nov 2018 04:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38208/anitools-web-a-web-tool-for-fast-genome-comparison-within-multiple-bacterial-strains</link>
	<title><![CDATA[ANItools web: a web tool for fast genome comparison within multiple bacterial strains]]></title>
	<description><![CDATA[<p><span>ANItools is a software package written by PERL scripts that can be run in a Linux/Unix system. If you want to compare bacterial genomes and calculate their average nucleotide identity (ANI), you could download and run this program directly. Or you could send us the genome sequence by email. Then we will do the analysis work for you.</span></p>
<p><span>https://academic.oup.com/database/article/doi/10.1093/database/baw084/2630454</span></p><p>Address of the bookmark: <a href="http://ani.mypathogen.cn/" rel="nofollow">http://ani.mypathogen.cn/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4636/molecular-and-computational-biology-research-school</guid>
  <pubDate>Fri, 20 Sep 2013 09:01:18 -0500</pubDate>
  <link></link>
  <title><![CDATA[Molecular and Computational Biology Research School]]></title>
  <description><![CDATA[
<p>The ambition of the Molecular and Computational Biology Research School (MCB) is to create an attractive and stimulating training environment for PhD students in molecular and computational biology, both to better serve the needs for relevant training in the field, and to stimulate crossdiscipline developments in the research of the parties.</p>

<p>http://www.uib.no/rs/mcb</p>
]]></description>
</item>

</channel>
</rss>