<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31351?offset=360</link>
	<atom:link href="https://bioinformaticsonline.com/related/31351?offset=360" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1469/prime-minister%E2%80%99s-100k-genome-project</guid>
	<pubDate>Thu, 08 Aug 2013 09:40:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1469/prime-minister%E2%80%99s-100k-genome-project</link>
	<title><![CDATA[Prime Minister’s 100k Genome Project]]></title>
	<description><![CDATA[<p>Genomics Ebgland is destined to sequence 100,000 patients over the next five year in England.&nbsp; A landmark project by british government.</p><p>Genomics England will play a key role in building on the UK&rsquo;s long track record as leader in medical science advances to push the boundaries by unlocking the power of DNA data. The UK will become the first ever country to introduce this technology in its mainstream health system &ndash; leading the global race for better tests, better drugs and above all better, more personalised care.</p><p>http://www.genomicsengland.co.uk/100k-genome-project/</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/1491/2013-nextgen-genomics-bioinformatics-technologies-ngbt-conference-new-delhi-india</guid>
  <pubDate>Thu, 08 Aug 2013 16:21:16 -0500</pubDate>
  <link></link>
  <title><![CDATA[2013 NextGen Genomics &amp; Bioinformatics Technologies (NGBT) Conference, New Delhi, INDIA]]></title>
  <description><![CDATA[
<p>2013 NextGen Genomics &amp; Bioinformatics Technologies (NGBT) Conference</p>

<p>SciGenom Research Foundation (SGRF) and Institute of Genomics and Integrative Biology (IGIB) are pleased to host the Next-Generation Sequencing and Bioinformatics for Genomics &amp; Healthcare conference.</p>

<p>In the ten years since the first human reference genome was completed for US$3 billion the sequencing technologies have radically changed leading to great reduction in sequencing cost. Today a human genome can be sequenced for under US$ 5000 in less than two weeks. It is expected that by the end of 2015 the cost of sequencing a human genome will drop to below thousand dollars. The next generation sequencing technologies over the past five years have enabled a large number of genomic studies that impact human health and disease. Also, this has made possible the growth of microbial, animal and plant genomics studies. While the data production has increased at a rapid pace challenges remain in analyzing and understanding the data. The conference will cover the next generation sequencing (NGS) technologies, bioinformatics for NGS and applications of NGS in many areas including personalized medicine.</p>

<p>For more info : http://www.scigenomconferences.com/2013/default.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/1720/postdoctoral-associate-bioinformatics-at-duke-university-medical-center</guid>
  <pubDate>Sat, 10 Aug 2013 18:38:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral Associate - Bioinformatics  at Duke University Medical Center]]></title>
  <description><![CDATA[
<p>The Department of Biostatistics and Bioinformatics at Duke University Medical Center is seeking a Postdoctoral Associate for a one year appointment to work on several high-dimensional research projects. The specific goals of the project are to identify genes or molecular markers that are predictive of clinical outcomes in renal and prostate cancer.</p>

<p>Candidates must have: a PhD degree in statistics, biostatistics or bioinformatics, extensive experience in analyzing high-dimensional data (microarray, SNP, CNVs) and of validation approaches. In addition, experience in penalized regression methods, data base manipulation; and strong programming skills in order to conduct Monte Carlo studies and applications (R). Candidate must have excellent communication skills (verbal, written and presentation), a strong proficiency in Linux system.</p>

<p>This position is available immediately and will be filled as soon as possible. Appointment could be extended beyond the first year based on additional funding.</p>

<p>For more information about the Department of Biostatistics and Bioinformatics, please visit our website: http://www.biostat.duke.edu.</p>

<p>For more info: http://biostat.duke.edu/sites/biostat.duke.edu/files/Halabi%20-%20Postdoc%20Job%20Posting%202013%20updated.pdf</p>

<p>Duke University is an Equal Opportunity/Affirmative Action Employer.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2021</guid>
	<pubDate>Mon, 12 Aug 2013 09:27:57 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2021</link>
	<title><![CDATA[What are the difference between BioRuby and BioGem?]]></title>
	<description><![CDATA[<p>I came across two diferent but matching term BioRuby and BioGem. What are the difference between these two term? If both are using same Ruby language for development then why did they develope two different biological packages.</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4090/computational-biology-in-the-21st-century-making-sense-out-of-massive-data</guid>
	<pubDate>Thu, 29 Aug 2013 08:32:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4090/computational-biology-in-the-21st-century-making-sense-out-of-massive-data</link>
	<title><![CDATA[Computational Biology in the 21st Century: Making Sense out of Massive Data]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/I99UiA_vaJQ" frameborder="0" allowfullscreen></iframe>Computational Biology in the 21st Century: Making Sense out of Massive Data    
    
Air date:  Wednesday, February 01, 2012, 3:00:00 PM
Category:  Wednesday Afternoon Lectures  
 
Description:  The last two decades have seen an exponential increase in genomic and biomedical data, which will soon outstrip advances in computing power to perform current methods of analysis. Extracting new science from these massive datasets will require not only faster computers; it will require smarter algorithms. We show how ideas from cutting-edge algorithms, including spectral graph theory and modern data structures, can be used to attack challenges in sequencing, medical genomics and biological networks. 

The NIH Wednesday Afternoon Lecture Series includes weekly scientific talks by some of the top researchers in the biomedical sciences worldwide. 

Author:  Dr. Bonnie Berger  
Runtime:  00:58:06  
Permanent link:  http://videocast.nih.gov/launch.asp?17563]]></description>
	
</item>

</channel>
</rss>