Applications are invited on plain paper from eligible candidates along with biodata and copies of certificates in support of age, qualification and experience for the following position:

Particulars Description

1. Position & No. JRF (Junior Research Fellow) 01

2. Title of the Project Molecular modeling and docking studies on Deguelin and its derivatives with cell cycle arrest, apoptosis and anti-angiogenesis pathway proteins in cancer cell signaling pathway

3. Tenure 3 years

4. Investigator Dr. K. V.Swamy

5. Institute Dr. D. Y. Patil Biotechnology and Bioinformatics Institute, Tathawade, Pune 411033.

5. Qualifications/Eligibility

Essential: NET (National Eligibility Test) qualified M. Sc Bioinformatics/ M. Tech Bioinformatics/M. Sc Biotechnology/M. Tech Biotechnology or Graduate degree in Professional course with NET qualification or Post graduation degree in professional course

The following examinations conducted by various Central Government Departments/Agencies are considered as National Eligibility Test (NET).

1. CSIR-UGC-LS
2. GATE (Graduate Aptitude Test in Engineering)
3. JAM (Joint Admission Test)
4. GPAT (Graduate Pharmacy Aptitude Test)
5. BET(Biotechnology Eligibility Test)
6. BINC(Bioinformatics National Consortium)
7. JEST( Joint Entrance Screening Test)
8. JGEEBILS(Joint Graduate Entrance Examination for Biology & Interdisciplinary Life Sciences)
9. NBHM Ph.D scholarship Screening Test
10. ICMR- JRF Entrance Examination
11. AICE (ICAR-All India competitive Examination )
(For all above examinations valid score considered at the time of interview)

Desirable: Knowledge and skills in Bioinformatics tools/ softwares

6. Monthly Emoluments Rs.25,000/ (As per DST-SERB rules)

7. Last date for submission of prescribed application 20/08/2016

Kindly send your applications to “Dr. K. V. Swamy, Asst.Professor, Dr. D. Y. Patil Biotechnology & Bioinformatics Institute, Survey No. 87/88, Mumbai-Pune Express Way, Tathawade, Pune - 411033, Maharashtra, India”. Highlight the envelope with “Application for post of JRF (Junior Research Fellow)”.

Note: No TA/DA will be paid for attending the interview.

Advertisement: http://careers.dpu.edu.in/Biotech.aspx

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

Project :“Genetic Transformation and Development of Elite Transgenic Maize (Zea mays L.) for Biotic and Abiotic Stresses Tolerance”.

Qualification: Ph.D. degree in:Biotechnology/Bioinformatics/Biochemistry/Plant Molecular Biology/Plant Physiology/Botany or any related area with evidence of prior experience in maize transformation.

Additional experience in plant transformation of any cereal crop would be preferable.

The appointment would initially be for one year.

How to apply
Interested applicants should send their detailed CV including brief synopsis regarding the previous research experience (along withcontact email address by email) to: Dr. Tanushri Kaul (tanushri@icgeb.res.in). Group Leader, Nutritional Improvement of Crops Group, International Centre for Genetic Engineering and Biotechnology, Aruna Asaf Ali Marg, New Delhi-110 067.

Closing date for applications: 22 August 2016.

More at http://www.icgeb.org/vacancies.html

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

More at http://www.nabi.res.in/Vacancies/NABI/ResearchFellowships/JRFSRFRA/2016/NABI8(18)2012-PME-3/Advt.pdf

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Sri Venkateswara College (University of Delhi)

New Delhi- 110021

1. Junior Research Fellow (1 Post)

Applications are invited for the post of Junior Research Fellow (JRF) under DST funded project which is purely temporary and is strictly for project duration only.

Title of project

No. of post

Remuneration (Rs.)

“Computational assisted Design and Synthesis of Novel Antimalarial Agents Embodying Structural Diversity Suitable for Protease Inhibitors”

(One)

Fellowship and HRA as per DST guidelines

Qualification

Post Graduate Degree in Basic Science (M.Sc./M.Tech in Bioinformatics/Biophysics) from a recognized University in India or abroad with at least 55% marks with NET qualification or Graduate Degree in Professional Course with NET Qualification or Post Graduate Degree in Professional Course.

Desirable

Fair knowledge of Computer Aided Drug Designing (CADD), Protein Structure modeling, molecular docking, and simulations are preferable.

2. Traineeship (1 Post)

Applications are invited for the position of traineeship in DBT-BTISnet funded Bioinformatics Infrastructure Facility (BIF) to carry out project work in the area of Bioinformatics.

Qualification

Applicant should be possess PG degree/PG diploma in Bioinformatics for traineeship. The traineeship is awarded for a period of six months from the date of joining and is not extendable. The selected candidates are entitled to receive a stipend of Rs. 8000/- per month (consolidate) for a period of 6 months.

=====================================================================

3. Studentship (1 Post)

Applications are invited for the position of Studentship in DBT-BTISnet funded Bioinformatics Infrastructure Facility (BIF) to carry out project work in the area of Bioinformatics.

Qualification

Candidates pursuing the Final Year of Post Graduate Degree in Basic Science (M.Sc.) or Post Graduate/ Graduate Degree in Professional Course (M.Tech/B.Tech) in Bioinformatics from a recognized University in India or abroad. The selected candidates are entitled to receive a stipend of Rs. 8000/- per month (consolidate) for a period of 6 months.

How to Apply?

Applicants are required to send applications on plain paper, stating the name, address, date of birth, educational qualification, experience and Institute, along with attested photocopies of mark sheets and certificates etc. by September 20, 2016 to:

The Coordinator

Bioinformatics Center, Sri Venkateswara College

Benito Juarez Road, Dhaula Kuan, New Delhi- 110021

Applications may also be sent by email to contact@bic-svc.ac.in. Strictly mention "Application for JRF, Traineeship or Studentship" in the subject line as the case may be.

Short listed candidates will be called for an interview. Canvassing in any form will be a disqualification. No TA/DA will be paid either for attending the interview or joining the post.

For more details visit our lab webpage: http://www.bic-svc.ac.in

kallisto

The Rearrangement Overview page describes the one or more breakpoints which make up a structural variant. A breakpoint is defined as a region or point where the sample sequence has altered from the reference sequence. Minimum interpretation is made of this data. One variant event can consist of one or multiple breakpoints. The Syntax (shown above the table) gives a detailed description of the variant and its location  (e.g. chr11:g.36585230_76606619del, a deletion of roughly 40Mb on chromosome 11). Syntax is based on HGVS mutation nomenclature recommendations [http://www.hgvs.org/rec.html]. 

http://cancer.sanger.ac.uk/cosmic/help/rearrangement/overview

Address of the bookmark: http://cancer.sanger.ac.uk/cosmic/help/rearrangement/overview

EDirect also provides an argument-driven function that simplifies the extraction of data from document summaries or other results that are returned in structured XML format. This can eliminate the need for writing custom software to answer ad hoc questions. Queries can move seamlessly between EDirect commands and UNIX utilities or scripts to perform actions that cannot be accomplished entirely within Entrez.

Address of the bookmark: https://www.ncbi.nlm.nih.gov/books/NBK179288/