The new features include

(i) building gene-based and supermatrix-based phylogenies using a single command,

(ii) testing and visualizing evolutionary models,

(iii) calculating distances between trees of different size or including duplications, and

(iv) providing seamless integration with the NCBI taxonomy database.

ETE is freely available at http://etetoolkit.org

Address of the bookmark: http://etetoolkit.org

More at http://ird.iitd.ac.in/sites/default/files/jobs/project/IITD-IRD-093-2016.pdf

Project: Indo-UK Centre for improvement of Nitrogen use efficiency in wheat Dr. Soma S. Marla, Pr. Scientist (Bioinformatics), Division of Genomic Resources, ICAR, NBPGR, ND.

Qualification: Ph.D. Degree in Computer Sciences/Bioinformatics OR 1. First class Master’s degree in any discipline of Plant Sciences with specialization in Computer Sciences/ Bioinformatics having 1st division or 60% marks or equivalent overall grade point average with at least two years of research experience as evidenced from Fellowship/ Associate ship. 2. NET qualification is essential for the candidates with 3+2 years B.Sc.+ M.Sc. Desirable: Demonstrated experience & skills in database design, management, UNIX OS, in NGS data analysis. Experience substantiated by publications of high quality will be preferred.

No.of Post: 1

Pay Scale: Rs. 40,000 (Ph.D)/ Rs + 30 % HRA; Rs.38,000 ( Masters Degree 0 + 30 % HRA).

Age Limit : below 40 years for RA position
How to apply
Applicants for RA post should send their complete CV (Advance copy of the application may be sent by email to :soma.marla@icar.gov.in or ssmarl@yahoo.com, should enclose the copy of the research publications; one page summary of their achievement relevant to the post applied for; and should enclose two reference letters (one must be from the person with whom worked latest). Shortlisted candidate will be intimated for interview by email.

The candidates who wish to attend the walk-in interview are requested to bring with them five copies of the CV (one copy with photograph) as per the format given below. Also, the candidates should bring the original documents such as degree certificates, marks sheets, publications, thesis, experience certificate etc. for verification.

Date of Interview: 17.8.2016.

More at http://www.nbpgr.ernet.in/Downloadfile.aspx?EntryId=7133

Address of the bookmark: https://github.com/yjx1217/LRSDAY

Applications are invited on plain paper from eligible candidates along with biodata and copies of certificates in support of age, qualification and experience for the following position:

Particulars Description

1. Position & No. JRF (Junior Research Fellow) 01

2. Title of the Project Molecular modeling and docking studies on Deguelin and its derivatives with cell cycle arrest, apoptosis and anti-angiogenesis pathway proteins in cancer cell signaling pathway

3. Tenure 3 years

4. Investigator Dr. K. V.Swamy

5. Institute Dr. D. Y. Patil Biotechnology and Bioinformatics Institute, Tathawade, Pune 411033.

5. Qualifications/Eligibility

Essential: NET (National Eligibility Test) qualified M. Sc Bioinformatics/ M. Tech Bioinformatics/M. Sc Biotechnology/M. Tech Biotechnology or Graduate degree in Professional course with NET qualification or Post graduation degree in professional course

The following examinations conducted by various Central Government Departments/Agencies are considered as National Eligibility Test (NET).

1. CSIR-UGC-LS
2. GATE (Graduate Aptitude Test in Engineering)
3. JAM (Joint Admission Test)
4. GPAT (Graduate Pharmacy Aptitude Test)
5. BET(Biotechnology Eligibility Test)
6. BINC(Bioinformatics National Consortium)
7. JEST( Joint Entrance Screening Test)
8. JGEEBILS(Joint Graduate Entrance Examination for Biology & Interdisciplinary Life Sciences)
9. NBHM Ph.D scholarship Screening Test
10. ICMR- JRF Entrance Examination
11. AICE (ICAR-All India competitive Examination )
(For all above examinations valid score considered at the time of interview)

Desirable: Knowledge and skills in Bioinformatics tools/ softwares

6. Monthly Emoluments Rs.25,000/ (As per DST-SERB rules)

7. Last date for submission of prescribed application 20/08/2016

Kindly send your applications to “Dr. K. V. Swamy, Asst.Professor, Dr. D. Y. Patil Biotechnology & Bioinformatics Institute, Survey No. 87/88, Mumbai-Pune Express Way, Tathawade, Pune - 411033, Maharashtra, India”. Highlight the envelope with “Application for post of JRF (Junior Research Fellow)”.

Note: No TA/DA will be paid for attending the interview.

Advertisement: http://careers.dpu.edu.in/Biotech.aspx

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

Project :“Genetic Transformation and Development of Elite Transgenic Maize (Zea mays L.) for Biotic and Abiotic Stresses Tolerance”.

Qualification: Ph.D. degree in:Biotechnology/Bioinformatics/Biochemistry/Plant Molecular Biology/Plant Physiology/Botany or any related area with evidence of prior experience in maize transformation.

Additional experience in plant transformation of any cereal crop would be preferable.

The appointment would initially be for one year.

How to apply
Interested applicants should send their detailed CV including brief synopsis regarding the previous research experience (along withcontact email address by email) to: Dr. Tanushri Kaul (tanushri@icgeb.res.in). Group Leader, Nutritional Improvement of Crops Group, International Centre for Genetic Engineering and Biotechnology, Aruna Asaf Ali Marg, New Delhi-110 067.

Closing date for applications: 22 August 2016.

More at http://www.icgeb.org/vacancies.html

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

More at http://www.nabi.res.in/Vacancies/NABI/ResearchFellowships/JRFSRFRA/2016/NABI8(18)2012-PME-3/Advt.pdf

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.