<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31353?offset=1430</link>
	<atom:link href="https://bioinformaticsonline.com/related/31353?offset=1430" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/1295/five-points-for-bioinformatics-softwaretools</guid>
	<pubDate>Mon, 05 Aug 2013 04:12:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/1295/five-points-for-bioinformatics-softwaretools</link>
	<title><![CDATA[Five points for bioinformatics software/tools]]></title>
	<description><![CDATA[<p><span>In the bioinformatics sector we mostly spend time on computational analysis of huge amounts of data and try to make sense of it, biologically. But, most of the newbie bioinformaticians are faced with dilemma when they receive biological sequence data for the first time. They mostly found confusing over open source, user friendly GUI, and commercial bioinformatics software. Don&rsquo;t be surprise this is true and also not an easy task to decide, because analytical step is the most crucial part and believe to be the biggest bottleneck in publishing paper in high impact journals. Through this blog I would like to address the pros and cons of both kind of software/tools and try to assist (Hmmm not really, It looks convince) you to make decision on your software selections.</span></p><p><span><img src="http://bioinformaticsonline.com/mod/photo/five.jpg" alt="image" style="border: 0px;"></span></p><p><span>The most common newbie questions are:</span><span></span></p><p><span>Should I try to use these free open source programs? &nbsp;Why are we not trying GUI software for computational analysis? Should I use commercial bioinformatics programs/software?&rdquo;</span><span><br /></span><span><br />1. Let&rsquo;s be open</span><span></span></p><p><span>We generally think free and cheap are useless. But this concept is not applicable when we discuss open source software. Mostly, the bioinformatics software is developed by highly competitive biological programmers who believe in open sharing of knowledge. They come under Open Bioinformatics Foundation or O|B|F which is a non-profit, volunteer run organization focused on supporting open source programming in bioinformatics. The best part about open source tools/software is that they&rsquo;re free to download the source code and read exactly what the program does. If you are so inclined, you can view all of the parts of the program and see the logical flow of the pipeline. In addition, open source makes an excellent learning tool for any beginning bioinformatician. Moreover, you can modify existing open source programs to deal with cutting-edge problems or to customize your pipeline.</span><span>&nbsp;</span><span>Apart from your computational and analysis work, most of the reviewer also prefers the open source based results so that they can validate the results if validation required.</span></p><p><span>2. Code headache</span><span></span></p><p><span>As a bioinformatician you are supposed to know the basics of programming languages, and if you are not good at it, then please learn it as soon as possible because you are not a bio-analyst but biological programmers. The<span>&nbsp;</span>open source programs usually lack dedicated service and support teams (often because they were the product of an overworked doc/postdoc!) so you are responsible for troubleshooting your own errors most of the time.<span>&nbsp;</span>We commonly receive the HELP email to support and assist to setup the pipeline; you can also find this kind of request on any QA forum. I personally believe this coding horror brings the biggest downside of open-source programs; where you need some programming skills in order to implement the program in your pipeline. But, if you are not able to fix the pipeline and modify the open source code according to your requirements them you should re-think on your bioinformatician name tag!!!</span><span></span></p><p><span>3. Dive into the codes</span><span></span></p><p><span>Some of the biologist turn bioinformatician says &ldquo;if you can do the same thing with commercial software then why to get migraine with weird codes&rdquo;, well this statement looks to me that guys are keen to learn swimming but still don&rsquo;t like to get wet. If you are still using paid software and doing your work by customer support and clicking some of the well-designed GUI button then perhaps you are not interested in learning and trying new and challenging bioinformatics works. You are missing the basic flavour of bioinformatics. Let&rsquo;s dive into the coding world, I am sure your will enjoy it. I recommend your to swim freely in code&rsquo;s sea, and enjoy the journey; do not merely watch it from the outside. &nbsp;</span></p><p><span>4. Paid does not mean better</span><span></span></p><p><span>The bioinformatics company which are specializes in bioinformatics solutions develop well designed/packed, user friendly software by using a large number of specialised scientist, programmers and support staff. They also provide good services to accomplice your biological analysis work. This means that if you hit a &lsquo;snag&rsquo; with your data, help is likely only a phone call away! These companies price their products competitively against the cost of a dedicated bioinformatician. You may be able to afford the program, but not the additional staff! Additionally, most of the functionality that you need in your analysis is already coded into the program. Need to plot a graph? Just click this button right here. It is that easy.</span><span>&nbsp;</span><span>But, as a bioinformatician this is not generally well encouraged approach in biological analysis work, because the software is not available to everyone and your data can&rsquo;t be validated. Moreover, there is very less chances that anyone will repeat your work or love to do similar kind of research (because not all the labs in the world are rich like yours).</span></p><p><span>5. Take a caution<br /><br />In biological analysis work, in which you deal GB/TB of data are having maximum chances of getting errors, so please be careful and always cross check your data before coming to any conclusion. Even an error in two line code can alter your entire analysis and display weird results. Some of the scientist blindly believes on commercial software, which is entirely wrong. Using proprietary tools does not absolve you of the need to actually read and research the type of analysis that you are doing. This is particularly true in the case of genome assembly and annotation.</span></p><p><span><br />At the end, I would like to tell only one think that open source solutions allows you to do more cutting edge analysis than the commercial tools. So let&rsquo;s go for it.</span></p><p>Disclaimer:</p><p>This is my personal view. I have nothing to do with any company or open source community.&nbsp;The views expressed on these pages are mine alone and not those of my current/past employers. I do reserve the right to remove comments left by spammers or off-topic comments.</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1469/prime-minister%E2%80%99s-100k-genome-project</guid>
	<pubDate>Thu, 08 Aug 2013 09:40:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1469/prime-minister%E2%80%99s-100k-genome-project</link>
	<title><![CDATA[Prime Minister’s 100k Genome Project]]></title>
	<description><![CDATA[<p>Genomics Ebgland is destined to sequence 100,000 patients over the next five year in England.&nbsp; A landmark project by british government.</p><p>Genomics England will play a key role in building on the UK&rsquo;s long track record as leader in medical science advances to push the boundaries by unlocking the power of DNA data. The UK will become the first ever country to introduce this technology in its mainstream health system &ndash; leading the global race for better tests, better drugs and above all better, more personalised care.</p><p>http://www.genomicsengland.co.uk/100k-genome-project/</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/1491/2013-nextgen-genomics-bioinformatics-technologies-ngbt-conference-new-delhi-india</guid>
  <pubDate>Thu, 08 Aug 2013 16:21:16 -0500</pubDate>
  <link></link>
  <title><![CDATA[2013 NextGen Genomics &amp; Bioinformatics Technologies (NGBT) Conference, New Delhi, INDIA]]></title>
  <description><![CDATA[
<p>2013 NextGen Genomics &amp; Bioinformatics Technologies (NGBT) Conference</p>

<p>SciGenom Research Foundation (SGRF) and Institute of Genomics and Integrative Biology (IGIB) are pleased to host the Next-Generation Sequencing and Bioinformatics for Genomics &amp; Healthcare conference.</p>

<p>In the ten years since the first human reference genome was completed for US$3 billion the sequencing technologies have radically changed leading to great reduction in sequencing cost. Today a human genome can be sequenced for under US$ 5000 in less than two weeks. It is expected that by the end of 2015 the cost of sequencing a human genome will drop to below thousand dollars. The next generation sequencing technologies over the past five years have enabled a large number of genomic studies that impact human health and disease. Also, this has made possible the growth of microbial, animal and plant genomics studies. While the data production has increased at a rapid pace challenges remain in analyzing and understanding the data. The conference will cover the next generation sequencing (NGS) technologies, bioinformatics for NGS and applications of NGS in many areas including personalized medicine.</p>

<p>For more info : http://www.scigenomconferences.com/2013/default.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/1720/postdoctoral-associate-bioinformatics-at-duke-university-medical-center</guid>
  <pubDate>Sat, 10 Aug 2013 18:38:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral Associate - Bioinformatics  at Duke University Medical Center]]></title>
  <description><![CDATA[
<p>The Department of Biostatistics and Bioinformatics at Duke University Medical Center is seeking a Postdoctoral Associate for a one year appointment to work on several high-dimensional research projects. The specific goals of the project are to identify genes or molecular markers that are predictive of clinical outcomes in renal and prostate cancer.</p>

<p>Candidates must have: a PhD degree in statistics, biostatistics or bioinformatics, extensive experience in analyzing high-dimensional data (microarray, SNP, CNVs) and of validation approaches. In addition, experience in penalized regression methods, data base manipulation; and strong programming skills in order to conduct Monte Carlo studies and applications (R). Candidate must have excellent communication skills (verbal, written and presentation), a strong proficiency in Linux system.</p>

<p>This position is available immediately and will be filled as soon as possible. Appointment could be extended beyond the first year based on additional funding.</p>

<p>For more information about the Department of Biostatistics and Bioinformatics, please visit our website: http://www.biostat.duke.edu.</p>

<p>For more info: http://biostat.duke.edu/sites/biostat.duke.edu/files/Halabi%20-%20Postdoc%20Job%20Posting%202013%20updated.pdf</p>

<p>Duke University is an Equal Opportunity/Affirmative Action Employer.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2021</guid>
	<pubDate>Mon, 12 Aug 2013 09:27:57 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2021</link>
	<title><![CDATA[What are the difference between BioRuby and BioGem?]]></title>
	<description><![CDATA[<p>I came across two diferent but matching term BioRuby and BioGem. What are the difference between these two term? If both are using same Ruby language for development then why did they develope two different biological packages.</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>