BOL: Related items

Research Associate@ School of Computational and Integrative Sciences under Jawaharlal Nehru University

Fri, 22 Nov 2013 19:06:44 -0600

School of Computational and Integrative Sciences under Jawaharlal Nehru University, New Delhi invited applications for filling up 4 posts of Research Associates (RA) and Junior Research Fellow (JRF) (2 posts each) purely on temporary basis, liable to be terminated at any time without prior notice or ceased/withdrawn by the funding agency. The vacancies are for a Department of Biotechnology, Government of India funded project entitled "Computational Core for Plant Metabolomics" (Project ID: 632) being administered by Prof Indira Ghosh. Interested candidates should send their applications till 13 December 2013.
Important Dates
Last Date for receipt of applications: 13 December 2013
Vacancy Details
Total Vacancies: 4 posts
Type of recruitment: Temporary
Sl. No.: 01
Name of the Post: Research Associate
No of Posts: 1 post
Remuneration: Rs. 23000 + 30%
Qualifications: PhD in Bioinformatics / computational biology / Biophysics / Physical Chemistry / Computer Science. Computational experience, proven by paper published, is a necessary qualification.
Sl. No.: 02
Name of the Post: Research Associate
No of Posts: 1 post
Remuneration: Rs. 23000 + 30%
Qualifications: PhD in Computational Biology / Bioinformatics & related subjects. Computational experience, proven by paper published, is a necessary qualification.
Sl. No.: 03
Name of the Post: Junior Research Fellow
No of Posts: 1 post
Remuneration: Rs. 12000 + 30%
Qualifications: M. Sc. / B. Tech. preferably in Computational Biology /Bioinformatics and related fields with experience in Website designing & maintenance of Database.
Sl. No.: 04
Name of the Post: Junior Research Fellow
No of Posts: 1 post
Remuneration: Rs. 12000 + 30%
Qualifications: M. Sc. / MCA / B. Tech. preferably in Computational Biology / Computer science with experience in Programming in Java / Python, C++ etc & designing of Database.
Selection Procedure: Selection will be done on the basis of candidates’ performance in the Interview.
Candidates short-listed / selected for Interview will be informed through email only.
How to Apply: Interested eligible candidates should send their applications, in the prescribed format, along with their current CV by post to “Prof Indira Ghosh, Project Investigator, Hall#6, School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067” so as to reach the concerned authority by 13 December 2013.
Name of the post applied for’ must be superscripted on the envelope containing the application.
NOTE: For the post of Research Associates, only those candidates who have submitted thesis are eligible to apply. However, salary will be provided as per DBT / DST guidelines (i.e. candidates who have qualified NET /BET / BINC will have higher pay scale).
Candidates interested to register for PhD may not apply for JRF.
More @ http://www.jnu.ac.in/Career/currentjobs.htm

Mash: fast genome and metagenome distance estimation using MinHash

Jit — Tue, 12 Dec 2017 17:30:12 -0600

Mash is normally distributed as a dependency-free binary for Linux or OSX (see https://github.com/marbl/Mash/releases). This source distribution is intended for other operating systems or for development. Mash requires c++11 to build, which is available in and GCC >= 4.8 and OSX >= 10.7.

See http://mash.readthedocs.org for more information.

Address of the bookmark: https://github.com/marbl/Mash/releases

Human Genome Meeting 2014, Geneva, Switzerland

Fri, 20 Sep 2013 12:36:44 -0500

The spectacular advances of the last few years resulted in the rapid analysis of the genome sequence of each individual. The biomedical world is now faced with the enormous challenges of assigning pathogenicity to each genomic variant, the functional analysis of the genome of each individual, and the accurate and detailed phenotypic characterization. Advances in these challenges are likely to fundamentally change the medical practice in a global scale.

This 2014 HUGO Meeting in Geneva will be a Forum for discussions on innovative approaches, and proposals to tackle the anticipated challenges.

Time : 27 April 2014 - 30 April 2014

For enquiries, please email hugo2014@mci-group.com or visit www.hugo-international.org

More at http://www.hgm2014-geneva.org/

MUMmer4: A fast and versatile genome alignment system

Jit — Sat, 03 Feb 2018 04:59:17 -0600

MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the nucmer program in MUMmer4 is easily able to handle alignments of large genomes;

Address of the bookmark: https://mummer4.github.io/

Molecular and Computational Biology Research School

Fri, 20 Sep 2013 09:01:18 -0500

The ambition of the Molecular and Computational Biology Research School (MCB) is to create an attractive and stimulating training environment for PhD students in molecular and computational biology, both to better serve the needs for relevant training in the field, and to stimulate crossdiscipline developments in the research of the parties.

http://www.uib.no/rs/mcb

Metassembler: merging and optimizing de novo genome assemblies

Rahul Nayak — Tue, 08 May 2018 04:52:33 -0500

Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.

Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.

Address of the bookmark: https://sourceforge.net/projects/metassembler/?source=directory

Murray Cox's Genomicus Lab

Thu, 26 Sep 2013 16:42:42 -0500

This group interested in modeling genome dynamics in following topics:

---how genetic variation is distributed within and between individuals,
---determining how this diversity changes over evolutionary time.

Hence, Cox group work at the interface between biology, statistics and computer science to address questions of outstanding biological importance through intrepretation of large genetic datasets.

Profile:
Associate Professor Murray Cox,
Inaugural Rutherford Fellow of the Royal Society of New Zealand, Principal Investigator in the BioProtection Research Center and Associate Investigator in the Allan Wilson Center for Molecular Ecology and Evolution
Email : m.p.cox@massey.ac.nz
Webpage: http://massey.genomicus.com/index.html

PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.

Surabhi Chaudhary — Mon, 11 Jun 2018 03:08:26 -0500

We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler. http://derisilab.ucsf.edu/software/price/

Address of the bookmark: http://derisilab.ucsf.edu/software/price/

04- Informatics Approach to Cancer - Interview with Dr. Joel Saltz

Mon, 07 Oct 2013 14:35:43 -0500

For additional information visit http://www.cancerquest.org/joel-saltz-interview. Dr. Joel Saltz is a Professor in the Departments of Pathology, Biostatistics and Bioinformatics, and Mathematics and Computer Science at Emory University. Dr. Saltz's research on bioinformatics spans several disciplines. One project involves applying computer analysis to medical imaging to yield better results for patients. As an example, a computer program may able to help doctors detect small cancers in a CT scan or mammogram. In this interview segment, Dr. Saltz discusses the informatics approach to cancer. To learn more about cancer and watch additional interviews, please visit the CancerQuest website at http://www.cancerquest.org.

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr