BOL: Related items

MUMmer4: A fast and versatile genome alignment system

Jit — Sat, 03 Feb 2018 04:59:17 -0600

MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the nucmer program in MUMmer4 is easily able to handle alignments of large genomes;

Address of the bookmark: https://mummer4.github.io/

Molecular and Computational Biology Research School

Fri, 20 Sep 2013 09:01:18 -0500

The ambition of the Molecular and Computational Biology Research School (MCB) is to create an attractive and stimulating training environment for PhD students in molecular and computational biology, both to better serve the needs for relevant training in the field, and to stimulate crossdiscipline developments in the research of the parties.

http://www.uib.no/rs/mcb

Metassembler: merging and optimizing de novo genome assemblies

Rahul Nayak — Tue, 08 May 2018 04:52:33 -0500

Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.

Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.

Address of the bookmark: https://sourceforge.net/projects/metassembler/?source=directory

Murray Cox's Genomicus Lab

Thu, 26 Sep 2013 16:42:42 -0500

This group interested in modeling genome dynamics in following topics:

---how genetic variation is distributed within and between individuals,
---determining how this diversity changes over evolutionary time.

Hence, Cox group work at the interface between biology, statistics and computer science to address questions of outstanding biological importance through intrepretation of large genetic datasets.

Profile:
Associate Professor Murray Cox,
Inaugural Rutherford Fellow of the Royal Society of New Zealand, Principal Investigator in the BioProtection Research Center and Associate Investigator in the Allan Wilson Center for Molecular Ecology and Evolution
Email : m.p.cox@massey.ac.nz
Webpage: http://massey.genomicus.com/index.html

PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.

Surabhi Chaudhary — Mon, 11 Jun 2018 03:08:26 -0500

We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler. http://derisilab.ucsf.edu/software/price/

Address of the bookmark: http://derisilab.ucsf.edu/software/price/

04- Informatics Approach to Cancer - Interview with Dr. Joel Saltz

Mon, 07 Oct 2013 14:35:43 -0500

For additional information visit http://www.cancerquest.org/joel-saltz-interview. Dr. Joel Saltz is a Professor in the Departments of Pathology, Biostatistics and Bioinformatics, and Mathematics and Computer Science at Emory University. Dr. Saltz's research on bioinformatics spans several disciplines. One project involves applying computer analysis to medical imaging to yield better results for patients. As an example, a computer program may able to help doctors detect small cancers in a CT scan or mammogram. In this interview segment, Dr. Saltz discusses the informatics approach to cancer. To learn more about cancer and watch additional interviews, please visit the CancerQuest website at http://www.cancerquest.org.

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Evolution and Cancer

Fri, 27 Sep 2013 11:28:49 -0500

Air date: Wednesday, January 04, 2012, 3:00:00 PM Time displayed is Eastern Time, Washington DC Local Category: Wednesday Afternoon Lectures Description: There is a broad consensus that cancer is the result of somatic cells having serially gained, by a series of mutations, the ability to grow independently, to recruit resources from the circulation and the stroma, to invade local tissues, and to found anatomically distant metastases, ultimately killing the host. From the point of view of the cancer-causing somatic cell population, this is evolution driven by mutation and selection. Genomics has resulted in a parallel consensus that the central functions of all eukaryotes are highly conserved, not only at the level of individual protein functions, but also complex biological pathways and systems. These ideas motivated a comparison between results of molecular genetic studies of experimental evolution in yeast and the molecular genetic phenomena associated with tumorigenesis and tumor progression. We find some very striking similarities, including recurring genomic rearrangements, alterations of the regulation of specific growth-promoting genes, population-genetic features that affect the fitness trajectories of growth rate variants in evolving populations, and physiological and metabolic similarities derived from the conservation of the basic plan of growth and cell multiplication among all eukaryotes. It is hoped that some of the insights from yeast will aid the interpretation of sequence changes found in tumors, especially in the urgent necessity to distinguish 'driver' from 'passenger' mutations." David Botstein's fundamental contributions to modern genetics include the development of genetic methods for understanding biological functions and the discovery of the functions of many yeast and bacterial genes. In 1980, Botstein and three colleagues proposed a method for mapping human genes that laid the groundwork for the Human Genome Project. The basic principle of the mapping scheme was to develop, by recombinant DNA techniques, random single-copy DNA probes capable of detecting DNA sequence polymorphisms when hybridized to restriction digests, or specific fragments, of an individual's DNA. The method was used in subsequent years to identify several human disease genes, such as Huntington's and BRCA1. Variations of this method enabled the sequencing phase of the Human Genome Project. In the 1990s Botstein, having moved to Stanford University School of Medicine, collaborated with Patrick O. Brown of Stanford in exploiting DNA microarrays to study genome-wide gene expression patterns in yeast and in human cancers. This required developing a new statistical method and graphical interface, widely used today to interpret genomic data. Botstein also has helped to create, with Michael Ashburner and Gerald Rubin, a bioinformatics initiative to unify the representation of gene and gene product attributes across all species, called Gene Ontology. He graduated from Harvard College and earned his doctorate from the University of Michigan. He worked at Massachusetts Institute of Technology from 1967 to 1988; served as vice president for science at Genentech from 1988 to 1990; chaired the Department of Genetics at the Stanford University School of Medicine from 1990 to 2003; and joined the Princeton University faculty in 2003. He has sat on numerous editorial boards and was the founding editor of Molecular Biology of the Cell. Among recent major awards, Bostein won the Peter Gruber Foundation Prize in Genetics in 2003, the Apple Science Innovator Award in 2008, and the Albany Medical Center Prize in 2010. The NIH Wednesday Afternoon Lecture Series includes weekly scientific talks by some of the top researchers in the biomedical sciences worldwide. For more information, visit: The NIH Director's Wednesday Afternoon Lecture Series Author: Dr. David Botstein, Princeton University Runtime: 00:59:58 Permanent link: http://videocast.nih.gov/launch.asp?17046

GFinisher: a new strategy to refine and finish bacterial genome assemblies

Jit — Thu, 26 Jul 2018 09:31:55 -0500

GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.

java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory

Address of the bookmark: http://gfinisher.sourceforge.net

Pre- or postdoctoral research fellowship in Structural Bioinformatics in Padova

Wed, 02 Oct 2013 15:12:22 -0500

University of Padova (URL: http://protein.bio.unipd.it/)

A research fellowship is available at the BioComputing Laboratory, University of Padova (URL: http://protein.bio.unipd.it/). A highly motivated and creative candidate is sought to work on structural bioinformatics. Specifically, the project entails the development of novel methods, tools and databases for the analysis of protein structures. The BioComputing Laboratory is a group of a dozen people working on several aspects of prediction of protein structure & function employing techniques at the intersection between biology, medicine, chemistry, physics & computer science. Our aim is to integrate the development of novel methods and their application to biologically relevant problems. We are looking for candidates with a solid Bioinformatics background, programming experience (Python, Perl, C++ and/or Java) and good knowledge of molecular biology (protein structure/function, signalling pathways). Candidates should have a degree with top marks, optionally hold a PhD, and be highly motivated to work on interdisciplinary research. Good knowledge of English, an open-minded spirit, being collaborative and creative are crucial. The fellowship, which should start in late 2013, is initially for one year. It will be commensurate to experience, can be extended depending on performance and may lead to a PhD degree. The successful candidate will be located at the BioComputing Laboratory, University of Padova. Travel support for conferences and/or research visits abroad may be provided. To apply, please send your CV, a brief description of your research background and the names of two (or more) references to Prof. Silvio Tosatto (Email: silvio.tosatto@unipd.it).

Contact Person (Referent): Silvio Tosatto
Ref. E-Mail: silvio.tosatto@unipd.it
Tel: +39 049 827 6269
Fax: +39 049 827 6260
Group Web Page: http://protein.bio.unipd.it/