<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31375?offset=1030</link>
	<atom:link href="https://bioinformaticsonline.com/related/31375?offset=1030" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22965/ra-bioinformatics-at-bharathidasan-university</guid>
  <pubDate>Sun, 28 Jun 2015 12:21:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Bharathidasan University]]></title>
  <description><![CDATA[
<p>National Facility for Marine Cyanobacteria <br />Department of Marine Biotechnology <br />Bharathidasan University <br />Tiruchirappalli -620024, Tamil Nadu </p>

<p>Applications are invited from individuals who have high motivation to do research for the below mentioned position, </p>

<p>1. Research Associate - 1 No. <br />in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24. </p>

<p>Title of the Project: “Establishment of National Repository for Micro algae &amp; Cyanobacteria” funded by Department of Biotechnology, Govt. of India </p>

<p>Qualification </p>

<p>1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA </p>

<p>Essential : Doctoral degree in relevant subject from recognized University/ Institutes <br />Desirable: Research experience in molecular biology and bioinformatics </p>

<p>Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.</p>

<p>Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/23149/raphael-lab</guid>
  <pubDate>Sat, 04 Jul 2015 19:05:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[Raphael Lab]]></title>
  <description><![CDATA[
<p>Raphael Lab research is focused on Bioinformatics and Computational Biology.</p>

<p>Current research interests include next-generation DNA sequencing, structural variation, genome rearrangements in cancer and evolution, and network analysis of somatic mutations in cancer. Earlier research included topics in comparative genomics, multiple sequence alignment, and motif finding.</p>

<p>More athttp://compbio.cs.brown.edu/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23627/ra-bioinformatics-at-nipgr</guid>
  <pubDate>Tue, 04 Aug 2015 18:53:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at NIPGR]]></title>
  <description><![CDATA[
<p>Applications are invited from suitable candidates for filling up one position of Research Associate (RA) in the Institute with Dr. Senthil-Kumar Muthappa, Scientist, NIPGR, in the scheme of "Short-Term Research Fellowship" programme. The position is completely on temporary basis with maximum duration of three years. The initial appointment will be for a period of one year, which can be curtailed or extended based on the performance of the candidate and discretion of the Competent Authority.</p>

<p>The candidate is expected to have experience in handling functional genomics tools to dissect defense responses against bacterial pathogens and drought stress tolerance. This project may involve use of bioinformatics tools, database development, large scale transcriptome profiling, virus-induced gene silencing and any other research work as assigned by the PI.</p>

<p>Qualification: Candidates having a Ph. D. degree in Bioinformatics/Plant Molecular Biology/Plant Physiology/Plant Pathology/Plant Breeding &amp; Genetics and strong publication record can apply. Candidates having prior work experience in using advanced molecular biology tools in laboratory with strong bioinformatics knowledge are preferred.</p>

<p>The Fellowship amount for the position will be given at par with the similar fellowships by DBT/DST.</p>

<p>NIPGR reserves the right to select the candidate against the above post depending upon the qualifications and experience of the candidate. Reservation of post shall be as per Govt. of India norms.</p>

<p>Eligible candidates may apply by sending hard copy of complete application in the given format with a cover letter showing interest and specifying the position. The attested copies of the mark-sheets, certificates, proof of research experience/publications are to be attached. The application should reach at the address given below within 15 days from the date of advertisement. The envelope must be superscribed by "Application for the post of RA under NIPGR Short-term research fellowship programme". No TA/DA will be paid for attending the interview.</p>

<p>ONLY hard copy of the application in the given format will be accepted.<br />www.nipgr.res.in/files/careers/format_RA2.doc</p>

<p>Dr. Senthil-Kumar Muthappa<br />Staff Scientist - III,<br />National Institute of Plant Genome Research (NIPGR)<br />Aruna Asaf Ali Marg, P.O. Box NO. 10531,<br />New Delhi - 110067</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/23633/biorg</guid>
  <pubDate>Tue, 04 Aug 2015 20:52:52 -0500</pubDate>
  <link></link>
  <title><![CDATA[BioRG]]></title>
  <description><![CDATA[
<p>This research group works on problems from the fields of Bioinformatics, Biotechnology, Data Mining, and Information Retrieval. The group's research projects includes Comparative Genomics of Bacterial genomes, Metagenomics, Genomic databases, Pattern Discovery in sequences and structures, micro-array data analysis, prediction of regulatory elements, primer design, probe design, phylogenetic analysis, medical image processing, image analysis, data integration, data mining, information retrieval, knowledge discovery in electronic medical records, and more. </p>

<p>More at http://biorg.cis.fiu.edu/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23379/jrf-in-bioinformatics-tezpur-universityn</guid>
  <pubDate>Fri, 17 Jul 2015 19:42:22 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF in Bioinformatics @ Tezpur Universityn]]></title>
  <description><![CDATA[
<p>Tezpur University: Napaam – 784 028:</p>

<p>Assam Applications are invited for Walk-in-Interview for the following temporary positions in the MHRD sponsored Centre of Excellence under FAST project entitled “Machine Learning Research and Big Data Analysis” under the Principal Investigator Professor D.K. Bhattacharyya, Department of Computer Science &amp; Engineering, Tezpur University.</p>

<p>Position : Senior Research Fellows (SRFs) in the field of (i) Bioinformatics (ii) Natural Language Processing / Speech Processing (iii) Cognitive Radio Networks / Optical Networks (iv) Network Security. No. of Positions : Five (05).</p>

<p>Qualification : First class in ME / M. Tech. in CSE / IT / ECE with research experience in relevant fields of research. Candidates having valid GATE / NET score shall be preferred.</p>

<p>Fellowship : Rs. 18,000/- (Rupees Eighteen Thousand) only per month.</p>

<p>Duration : Two (02) years and may be extended depending on status of the project.</p>

<p>Position : Junior Research Fellows (JRFs) in the field of Bioinformatics</p>

<p>No. of Positions : One (01).</p>

<p>Qualification : First class in B. Tech. in CSE / IT/ ECE or MCA with consistently good academic records. Candidates with M. Tech. in CSE / IT / ECE shall be preferred.</p>

<p>Fellowship : Rs. 12,000/- (Rupees twelve Thousand) only per month.</p>

<p>Duration : Two (02) years and may be extended depending on status of the project.</p>

<p>Interested candidates may send their application on plain paper by post along with his/her educational qualifications, research experience certificates (for Senior Research Fellow), 02 copies of recent passport/stamp size photograph and contact phone number to Prof. D.K. Bhattacharyya, Principal Investigator, Department of Computer Science &amp; Engineering, Tezpur University, Napaam- 784028 or mail it to dkb@tezu.ernet.in (or to smh@tezu.ernet.in) within 15 days of publication of this advertisement.</p>

<p>Advertisement: www.tezu.ernet.in/ProjectWalkin/Advt_CoE_5816-A.pdf</p>
]]></description>
</item>

</channel>
</rss>