<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31382?offset=1630</link>
	<atom:link href="https://bioinformaticsonline.com/related/31382?offset=1630" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</guid>
	<pubDate>Tue, 12 Dec 2017 17:30:12 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</link>
	<title><![CDATA[Mash: fast genome and metagenome distance estimation using MinHash]]></title>
	<description><![CDATA[<p>Mash is normally distributed as a dependency-free binary for Linux or OSX (see&nbsp;<a href="https://github.com/marbl/Mash/releases">https://github.com/marbl/Mash/releases</a>). This source distribution is intended for other operating systems or for development. Mash requires c++11 to build, which is available in and GCC &gt;= 4.8 and OSX &gt;= 10.7.</p>
<p>See&nbsp;<a href="http://mash.readthedocs.org/">http://mash.readthedocs.org</a>&nbsp;for more information.</p><p>Address of the bookmark: <a href="https://github.com/marbl/Mash/releases" rel="nofollow">https://github.com/marbl/Mash/releases</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4352/jrf-bharathidasan-university</guid>
  <pubDate>Sat, 07 Sep 2013 14:20:03 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF @ BHARATHIDASAN UNIVERSITY]]></title>
  <description><![CDATA[
<p>Department of Bioinformatics<br />School of Life Sciences<br />BHARATHIDASAN UNIVERSITY,<br />TIRUCHIRAPPALLI-620 024</p>

<p>WALK-IN-INTERVIEW FOR JUNIOR RESEARCH FELLOWSHIP</p>

<p>Project title: Structural and Functional Evolution of Bacterial ADP-ribosylation Superfamily–A Special Emphasis for Engineering Immunotoxins from Binary toxin A Funding Agency: Life Science Research Board, Defence Research and Development Organization, New Delhi</p>

<p>Tenure of the project: Three years or till the end of the project period.</p>

<p>Position: Junior Research Fellow (1 no.)</p>

<p>Essential qualification: First class in M.Sc. in Genomics/Biotechnology/ Microbiology/ Biochemistry/Life Sciences</p>

<p>Desirable qualification: Experience in an area relevant (Molecular Microbiology, Protein engineering and Structural Bioinformatics) to the project.</p>

<p>Fellowship: Rs. 16, 000 per month plus HRA as per University rule.</p>

<p>Upper age limit: 28 years</p>

<p>Date of interview: 16-09-2013</p>

<p>Venue of interview: Department of Bioinformatics, Bharathidasan University, Tiruchirappalli -620 024, Tamil Nadu</p>

<p>The above post is purely temporary and will be terminated with three month notice. The Terms and the condition of the appointment shall be governed according to DRDO, Govt. of India. The eligible candidates will bring their original certificates and documents at the time of interview. No TA/DA will be paid for attending the interview.</p>

<p>Dr. P. CHELLAPANDI<br />Principal Investigator,<br />Department of Bioinformatics,<br />Bharathidasan University,<br />Tiruchirappalli -620 024, Tamil Nadu</p>

<p>Advertisement: http://www.bdu.ac.in/tender_list.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4482/bioinformatics-definitions-and-applications</guid>
	<pubDate>Thu, 12 Sep 2013 15:04:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4482/bioinformatics-definitions-and-applications</link>
	<title><![CDATA[Bioinformatics definitions and applications !!!]]></title>
	<description><![CDATA[<p>There have been long discussion amongst several specialized/expert educator regarding bioinformatics arena, but everyone explain bioinformatics with their own view. I tried to explain it with a cartoon. Hope you all will like it.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4482" length="49464" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4575/hiv-phd-and-msc-research-positions</guid>
  <pubDate>Mon, 16 Sep 2013 18:55:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[HIV PhD and MSc Research Positions]]></title>
  <description><![CDATA[
<p>SANBI are looking to recruit two MSc students and a PhD student who are interested in implementing a computational biology approach to explore HIV’s glycan shield. Successful candidates for the MSc should hold an honours degree in physics, computer science or biological sciences while PhD applicants should hold an honours degree and a MSc in one or more of physics, computer science or biological sciences.</p>

<p>As these positions are funded by the South African National Research Foundation (NRF) priority will be given to South African citizens and permanent residents however exceptional applicants who do not fulfil these criteria may be considered.</p>

<p>Applications including a CV outlining your experience together with a cover letter detailing why you are a suitable candidate should be sent to simon_at_sanbi.ac.za by 30th September 2013.</p>

<p>More @ http://www.sanbi.ac.za/hiv-phd-and-msc-research-positions/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4657/giovanni-parmigiani-lab</guid>
  <pubDate>Fri, 20 Sep 2013 13:21:41 -0500</pubDate>
  <link></link>
  <title><![CDATA[Giovanni Parmigiani Lab]]></title>
  <description><![CDATA[
<p>Scientific Interests:</p>

<p>Models and software for predicting who is at risk of carrying genetic variants that confer susceptibility to cancer. Application to breast, ovarian, colorectal, pancreatic and skin cancer.</p>

<p>Statistical methods for the analysis of high throughput genomic data: analysis of cancer genome sequencing projects; integration of genomic information across technologies; cross-study validation of genomics results.</p>

<p>Statistical methods for comparative effectiveness research: comprehensive models for lifetime history of chronic disease outcomes; Bayesian meta-analysis; Bayesian causal inference; decision analysis.</p>

<p>Bayesian modeling and computation: multilevel models; decision theoretic approaches to inference; sequential experimental design and their application to adaptive and multistage studies in clinical and epidemiological research.</p>

<p>http://bcb.dfci.harvard.edu/~gp/index.html</p>

<p>http://scholar.google.com/citations?user=OlpYP3UAAAAJ&amp;hl=en</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4755/sundar-lab</guid>
  <pubDate>Mon, 23 Sep 2013 11:10:16 -0500</pubDate>
  <link></link>
  <title><![CDATA[Sundar Lab]]></title>
  <description><![CDATA[
<p>Area of interest 		</p>

<p>Understanding DNA-protein interactions, genome engineering<br />Computational Genomics and Bioinformatics<br />Secondary metabolite biosynthesis, metabolic engineering</p>

<p>Ongoing Projects:</p>

<p>"Betraying the parasite’s redox system: Studies on spermidine synthase of Leishmania donovani " </p>

<p>"Towards modifying nature's DNA-recognition system" </p>

<p>"Yield enhancement strategies for production of therapeutic compounds by cell and tissue cultures of Tinospora cordifolia (willd.) Miers ex Hook. F. &amp; Thoms" </p>

<p>"Program support for Computational Genomics" </p>

<p>More at http://web.iitd.ac.in/~sundar/</p>
]]></description>
</item>

</channel>
</rss>