<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31382?offset=490</link>
	<atom:link href="https://bioinformaticsonline.com/related/31382?offset=490" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4755/sundar-lab</guid>
  <pubDate>Mon, 23 Sep 2013 11:10:16 -0500</pubDate>
  <link></link>
  <title><![CDATA[Sundar Lab]]></title>
  <description><![CDATA[
<p>Area of interest 		</p>

<p>Understanding DNA-protein interactions, genome engineering<br />Computational Genomics and Bioinformatics<br />Secondary metabolite biosynthesis, metabolic engineering</p>

<p>Ongoing Projects:</p>

<p>"Betraying the parasite’s redox system: Studies on spermidine synthase of Leishmania donovani " </p>

<p>"Towards modifying nature's DNA-recognition system" </p>

<p>"Yield enhancement strategies for production of therapeutic compounds by cell and tissue cultures of Tinospora cordifolia (willd.) Miers ex Hook. F. &amp; Thoms" </p>

<p>"Program support for Computational Genomics" </p>

<p>More at http://web.iitd.ac.in/~sundar/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5210/sandelin-group</guid>
  <pubDate>Mon, 30 Sep 2013 19:12:58 -0500</pubDate>
  <link></link>
  <title><![CDATA[Sandelin group]]></title>
  <description><![CDATA[
<p>Sandelin group have a deep interest in most biology, but focus on gene regulation and the many areas that are connected with this, including transcriptomics, epigenetics and technological and informatics aspects.</p>

<p>The group is both computational and experimental.</p>

<p>We ask biological questions to large datasets made using novel genomics techniques, with the help of computers. One of the strengths in the group are the many connections to high-profile experimental laboratories which supply data to be analyzed.</p>

<p>Lab webpage @ http://people.binf.ku.dk/albin/Sandelin_group_at_the_Bioinformatic_Centre/The_Sandelin_group.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4945/national-training-on-bioinformatics-computational-tools-for-microbial-research-nov-19-to-30-2013</guid>
  <pubDate>Fri, 27 Sep 2013 10:49:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[National Training on Bioinformatics  Computational Tools for Microbial Research  Nov 19 to 30, 2013]]></title>
  <description><![CDATA[
<p>Agricultural research in modern scientific arena is being represented by proper integration among various research fields of biological, chemical and physical sciences, because this field encompasses many more complexities of biology in nature. In the era of fast accumulating biological data coming out from the research on many crop plants, live stocks and microbes and the impact of changing climate, habitat and other interrelations on these biological entities, bioinformatics has come forward across the globe to solve the problems of analysis, prediction, storage, management, pattern recognition, submission, retrieval and storage of the data to find out a fruitful outcome. This area is becoming increasingly important in the context of systems biology approach where a holistic approach is required to understand the biology and chemistry of the biological entities and their behavior during environmental interactions to resolve the harmful impact of biotic or abiotic causes on crop plants, animals, fishes, livestock sector, beneficial insects as well as microbes. The National Training program on ‘Computational Tools for Microbial Research” is an initiative for the capacity building of NARS scientists/researchers in this most emerging area and fast developing area of i.e. agricultural bioinformatics.</p>

<p>Contact The Director, National Bureau of Agriculturally Important Microorganisms, Kusmaur, Maunath Bhanjan-275101 (U.P.); Phone: 0547-2530080, Fax: 0547-2530358, e mail: nbaimicar@gmail.com; website: www.nbaim.org.in OR</p>

<p>Dr. Dhananjaya P. Singh, Senior Scientist &amp; CCPI, NABG project, NBAIM, Maunath Bhanjan, 275101; Mob.- 09415291703; e mail - dpsfarm@rediffmail.com, nabg.nbaim@gmail.com </p>

<p>More at http://www.nbaim.org.in/Announc.aspx?cd=36</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23924/embl-postdoc-position-in-bacterial-gene-gain-loss</guid>
  <pubDate>Thu, 20 Aug 2015 14:09:21 -0500</pubDate>
  <link></link>
  <title><![CDATA[EMBL Postdoc position in Bacterial Gene Gain Loss]]></title>
  <description><![CDATA[
<p>A post-doctoral fellowship is available in the research groups of Nick Goldman (EBI) and John Welch (Genetics Department, Cambridge University) under the EMBL-EBI / Cambridge Computational Biomedical Postdoctoral Fellowship scheme.</p>

<p>The project is on bacterial gene gain and loss and emerging pathogenicity, and is described in full here: https://www.ebi.ac.uk/research/postdocs/ebpods/projects/goldman-welch-2015 . The EMBL-EBI / Cambridge Computational Biomedical Postdoctoral (“EBPOD”) </p>

<p>The closing date for applications is 3 September 2015. Nick Goldman EMBL-European Bioinformatics Institute Nick Goldman </p>

<p>More at https://www.ebi.ac.uk/research/postdocs/ebpods/projects/goldman-welch-2015</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5254/mike-ritchie-lab</guid>
  <pubDate>Wed, 02 Oct 2013 15:25:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[Mike Ritchie Lab]]></title>
  <description><![CDATA[
<p>Mike Ritchie Lab primary research focus is the detection of susceptibility genes for common diseases such as cancer, diabetes, hypertension, and cardiovascular disease, among others. The approaches will involve the development and application of new statistical methods with a focus on the detection of gene-gene interactions associated with human disease.</p>

<p>Gene expression and protein expression patterns between normal and non-normal tissues is a growing area of research that may lead to the identification of candidate genes for understanding the etiology of common, complex diseases. </p>

<p>Lab homepage @ http://ritchielab.psu.edu/ritchielab/</p>
]]></description>
</item>

</channel>
</rss>