<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31526?offset=310</link>
	<atom:link href="https://bioinformaticsonline.com/related/31526?offset=310" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5947/jrf-national-jalma-institute-of-leprosy-and-other-mycobacterial-diseases</guid>
  <pubDate>Mon, 28 Oct 2013 10:42:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF @ NATIONAL JALMA INSTITUTE OF LEPROSY AND OTHER MYCOBACTERIAL DISEASES]]></title>
  <description><![CDATA[
<p>NATIONAL JALMA INSTITUTE OF LEPROSY AND OTHER MYCOBACTERIAL DISEASES</p>

<p>(INDIAN COUNCIL OF MEDICAL RESEARCH)</p>

<p>P.O BOX 101,<br />Dr. M. Miyazaki Marg,<br />Tajganj, Agra - 282001</p>

<p>Applications are invited for a walk-in interview to be held in the Seminar Hall of the on 15th November, 2013, 9:30 am for temporary positions of JRF, Lab Technician and Field attendant in a ICMR funded project entitled "Elucidating the strain differentiation and transmission dynamics of M. leprae through simple sequence repeats ISSR-PCR marker"</p>

<p>1. JRF (one Post)</p>

<p>    Essential qualification: Candidates with M.Sc/IVI.Tech or equivalent degree in any life science related subjects with UGC-CSIR/ICMR/DBT-Net qualified</p>

<p>    Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.</p>

<p>    Age. Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>    Emoluments: Rs. 6,000 + 20% HRA per Month</p>

<p>2. Lab Technician (One Post)</p>

<p>    Essential Qualification: 12th with DMLT/B.SCA4.SC in Life sciences</p>

<p>    Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.</p>

<p>    Age: Maximum 30 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>    Emoluments: Rs13,760/ Per Month</p>

<p>3. Field Attendant (One Post)</p>

<p>Essential Qualification: 10th Pass</p>

<p>Desirable Qualification: Experience in field work</p>

<p>Age: Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>Emoluments: Rsl2,040l Per Month</p>

<p>Terms: posts are purely temporary. Appointment will be initially made for a period of one (01) year and may be extended further based on the performance of the candidate up to completion of the project.</p>

<p>Application &amp; Selection procedure: candidates have to appear in the walk-in-interview in person along with an application/CV on plain paper giving details of at educational qualificationq experience and submit photocopies of relevant documents at the time of interview. Selection will be based on the performance of the candidate in the interview' Candidates will not be sent any interview call letter separately. No TA/DA will be paid to the candidate for appearing in the interview. selection is not possible without appearing in the interview. All candidates must report by 9:00am on the date of interview. Advance copy of CV may be sent to m.sarathipartha@gmail.com</p>

<p>Advertisement: http://www.jalma-icmr.org.in/P_S_M_advertisment.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44370/ncbiblast-2141-now-available</guid>
	<pubDate>Wed, 30 Aug 2023 02:36:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44370/ncbiblast-2141-now-available</link>
	<title><![CDATA[NCBIBLAST+ 2.14.1 now available]]></title>
	<description><![CDATA[<p><a href="https://www.linkedin.com/feed/hashtag/?keywords=ncbiblast&amp;highlightedUpdateUrns=urn%3Ali%3Aactivity%3A7101231946264924160">#NCBIBLAST</a><span>+ 2.14.1 now available with improved documentation, faster and more reliable database downloads, and some bug fixes.&nbsp;</span></p><p>Check out the changes they made.</p><p>They added the&nbsp;<code><span>cleanup-blastdb-volumes.py</span></code>&nbsp;script to remove unused BLAST database volumes. Read the documentation&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK592857/">here</a>.</p><p>They also switched the protocol from&nbsp;<code><span>ftp</span></code>&nbsp;to&nbsp;<code><span>https</span></code>&nbsp;to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the&nbsp;<code><span>update_blastdb.pl</span></code>&nbsp;script.</p><p>And fixed a few bugs related to downloading data from the NCBI, and&nbsp;<code><span>mt_mode</span></code>&nbsp;crashing&nbsp;<code><span>blastn</span></code>&nbsp;and&nbsp;<code><span>blastx</span></code>.</p><p>Check out the&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK131777/">release notes</a>.</p><p>Download&nbsp;<a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.14.1/">BLAST+ 2.14.1</a></p><p>Questions or comments? Please write the&nbsp;<a href="https://support.nlm.nih.gov/support/create-case/">BLAST help desk</a>.</p><p><span><span>More info and download:</span>&nbsp;https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html</span></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7815/post-doc-in-systems-genetics</guid>
  <pubDate>Wed, 08 Jan 2014 19:23:37 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post-doc in Systems Genetics]]></title>
  <description><![CDATA[
<p>Gagneur lab at Gene Center, Ludwig-Maximilians-Universitaet, Munich, Germany</p>

<p>Deadline for applications : January 15, 2014.</p>

<p>Description :</p>

<p>We seek a talented and motivated post-doc to develop computational methods for inferring the molecular basis of genetic diseases by integration of personal omics data. Research topics include: identifying causal mutations of rare disease patients by meta-analysis; inferring disease-causing molecular pathways from genotype, human phenotypes, and omics profile of patient-derived cell lines; and causal inference from longitudinal omics studies of patients. The developed methods will be applied to analyze data from our medical collaborators.</p>

<p>Candidates must either hold a PhD in computational biology or bioinformatics, or hold a PhD in physics, statistics, or applied mathematics with practical experience with high-dimensional data analysis. Experience in quantitative genetics is a plus. Applicants must have a proven publication record and an interest for translational research.</p>

<p>The Gagneur lab is a young, lively and multidisciplinary group with a research focus on systems genetics and gene regulation. It is located at the Gene Center of the LMU (University of Munich), an interdisciplinary institution whose 16 independent research groups investigate the regulation of gene expression at all levels - from the underlying molecular mechanisms to the biological system. The institute is located on the biomedical research campus Munich-Grosshadern, offering a dynamic, interactive and internationally oriented research environment. The dynamism of Munich and the proximity of the Alps provide an excellent quality of life.</p>

<p>The salary is according to the TV-L (German academic salary scale).<br />Applications including a cover letter, CV, and references must be sent by January 15th 2014 to Julien Gagneur (gagneur@genzentrum.lmu.de)</p>

<p>About the lab: http://www.gagneur.genzentrum.lmu.de</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</guid>
	<pubDate>Wed, 04 Dec 2013 02:11:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</link>
	<title><![CDATA[Computer experts in biotechnology laboratory]]></title>
	<description><![CDATA[<p>Only bioinformatician can understand that <strong>multiplication</strong> and <strong>division</strong> are different but same thing :)</p><p><span>Disclaimer:</span>&nbsp;This cartoon is solely designed to create humour and fun, not to offend any computer experts.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/7032" length="35726" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/6380/hidden-markov-models-viterbi-algorithm-markov-chain-exploration-with-script</guid>
	<pubDate>Thu, 14 Nov 2013 13:36:56 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/6380/hidden-markov-models-viterbi-algorithm-markov-chain-exploration-with-script</link>
	<title><![CDATA[Hidden Markov Models, Viterbi Algorithm, Markov Chain Exploration with script]]></title>
	<description><![CDATA[<p><strong>Hidden Markov Models, the Viterbi Algorithm, and CpG Islands (in VB6)</strong></p><p><strong>Problem :</strong></p><p>The CG island is a stretch of DNA (usually longer than 200 bases) in which the frequency of the CG sequence is higher than other regions. It is also called the CpG island, where "p" simply indicates that "C" and "G" are connected by a phosphodiester bond.<br /><br />CpG islands are often located around the promoters of housekeeping genes (which are essential for general cell functions) or other genes frequently expressed in a cell. At these locations, the CG sequence is not methylated. By contrast, the CG sequences in inactive genes are usually methylated to suppress their expression. The methylated cytosine may be converted to thymine by accidental deamination. Unlike the cytosine to uracil mutation which is efficiently repaired, the cytosine to thymine mutation can be corrected only by the mismatch repair which is very inefficient. Hence, over evolutionary time scales, the methylated CG sequence will be converted to the TG sequence.</p><p>Find step wise explanationand implementation steps at <a href="http://dna.cs.byu.edu/bio465/Labs/hmm.shtml">http://dna.cs.byu.edu/bio465/Labs/hmm.shtml</a></p><p>Source code with explanation <a href="http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/">http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/</a></p><p>Fore detail understanding of HMM read this excellent tutorial <a href="http://www.cs.ubc.ca/~murphyk/Software/HMM/labman2.pdf">http://www.cs.ubc.ca/~murphyk/Software/HMM/labman2.pdf</a></p><p>Viterbi Algo at <a href="http://en.wikipedia.org/wiki/Viterbi_path">http://en.wikipedia.org/wiki/Viterbi_path</a></p><p>For firther reading Wiki page <a href="http://en.wikipedia.org/wiki/Hidden_Markov_model">http://en.wikipedia.org/wiki/Hidden_Markov_model</a></p><p>On CpG island paper and for indepth understanding <a href="http://www.biomedcentral.com/1471-2164/12/S2/S10">http://www.biomedcentral.com/1471-2164/12/S2/S10</a></p><p>&nbsp;</p><p>If you are more interested in exploring&nbsp;Markov Chain Exploration and understand it with graphical version please visit <a href="http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1">http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1</a></p><p>Reference:</p><p>1.<a href="http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1">http://www.planet-source-code.com</a></p><p>2. <a href="http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/">http://www.tannerhelland.com</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6562/molecular-bioinformatics-lab-mbl</guid>
  <pubDate>Tue, 19 Nov 2013 18:23:27 -0600</pubDate>
  <link></link>
  <title><![CDATA[Molecular Bioinformatics Lab (MBL)]]></title>
  <description><![CDATA[
<p>The main subject of interest in our laboratory is the study of the relationship among sequence, structure, and function in proteins and nucleic acids. Our research can be divided in two major topics:</p>

<p>the study of the sequence-structure relationship<br />(application -&gt; structure prediction)<br />the study of the structure-function relationship<br />(application -&gt; function prediction)</p>

<p>Therefore, anything related to the configuration (sequence) and conformation (structure) in atomic systems of proteins and nucleic acids, and the interaction of these with other elements (function) is of our major interest.</p>

<p>Lab page @ http://melolab.org/mbl/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6818/scientist-positions-gujarat-state-biotechnology-mission</guid>
  <pubDate>Mon, 25 Nov 2013 10:26:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist Positions @ Gujarat State Biotechnology Mission]]></title>
  <description><![CDATA[
<p>Gujarat State Biotechnology Mission invite applications [Online Only] under various projects* namely Gujarat Biodiversity Gene Bank (BioGene), Gujarat Institute of Genomics (GIG), Gujarat Institute of Bioinformatics [GIBS] and Gujarat Institute of Marine Biotechnology. Eligible candidates can Apply through online application portal.</p>

<p>1 Scientist E 3</p>

<p>50,000/-</p>

<p>M.Sc. in Life sciences or Plant Sciences or Biotechnology or Microbiology or Bioinformatics or Ph.D. from a recognized university in any of above subject.</p>

<p>Minimum 8 Yrs. of experience after M.Sc. or 5 Yrs. of experience after Ph.D. in responsible position of work in R &amp; D in the area of genomics/ conservation biotechnology/bioinformatics/Planning/Scientific Administration in Science and technology organization. Highly qualified in the area of modern biology, as evidenced through research experience and proven ability to carry out work in the area of conservation biotechnology. Age limit not exceeding 40yrs.</p>

<p>2 Scientist B 6</p>

<p>30,000/-</p>

<p>M.Sc. in Life sciences or Plant Sciences or Biotechnology or Microbiology or Bioinformatics or Ph.D. from a recognized university in any of above subject shall be preferred.</p>

<p>Minimum 3 Yrs. of experience after M.Sc. in responsible position of work in R &amp; D in the area of genomics/ conservation biotechnology/ bioinformatics /Planning/Scientific Administration in Science and technology organization. Highly qualified in the area of modern biology, as evidenced through research experience and proven ability to carry out work in the area of conservation biotechnology. Age limit not exceeding 35yrs.</p>

<p>The positions are purely on contractual basis for 11 months. Interested candidates can apply online in specified format available at "http://leogen.in/recruit/" The last date of applying is 24th December, 2013. Applications must be submitted online only. Applications submitted in any other format except online prescribed performa will be rejected. Candidates in service must apply through proper channel. Candidates will be required to provide original documents along with duly filled and signed application Performa, as and when called for interview.</p>

<p>For more details please visit the website URL : http://leogen.in/recruit</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7088/gabi</guid>
  <pubDate>Fri, 06 Dec 2013 16:43:01 -0600</pubDate>
  <link></link>
  <title><![CDATA[GABi]]></title>
  <description><![CDATA[
<p>GABi Research<br />The major researching fields defined as the GABi scope are described next:<br />    Sequence Analysis<br />    Protein Structure Prediction<br />    Comparative Genomics<br />    Functional Analysis of Residues on Protein Families<br />    Gene/Protein Networks<br />    Genome structure &amp; base composition<br />    Highthroughput data analysis from NGS</p>

<p>Lab Page http://gabi.cidbio.org/index/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7214/lapti-lab</guid>
  <pubDate>Thu, 12 Dec 2013 18:19:12 -0600</pubDate>
  <link></link>
  <title><![CDATA[LAPTI Lab]]></title>
  <description><![CDATA[
<p>The main theme of our research is the understanding of how genetic information is decoded from DNA into RNA and proteins. Someone may find this topic a little strange and argue that we already know how this is happening.</p>

<p>Translational recoding. </p>

<p>RNA editing. </p>

<p>Evolution of the genetic code and translation.</p>

<p>More at http://lapti.ucc.ie/research.html</p>

<p>Lab page http://lapti.ucc.ie/index.html</p>
]]></description>
</item>

</channel>
</rss>