Here is a list of what is changing:

1. All databases at the root level will be dbV5.
2. The dbV5 file naming,  “_v5” will be removed. Databases with  no “_vX” descriptor will be dbV5.
3. dbV4 tarballs will be renamed with "_v4", files included in tarball will not be renamed.
4. dbV4 databases will be moved to a v4 subdirectory.
5. As of 1/13/20 the Cloud directory will be frozen with no more new entries.
6. The will be no more updates to dbV4 databases.
7. The FASTA directory will contain nr, nt, swissprot, and pdbaa files.

If you have any questions or concerns, please contact blast-help@ncbi.nlm.nih.gov

Essential requirements: Experience of using bioinformatics tools.

Experience of working in Linux. Basic knowledge of computer network administration.

Desirable: Knowledge of Linux installation/administration and proficiency in either of the following:

Shell/PERL/Java/Python/VB/Oracle/MySQL/C/CUDA.

Qualification: PhD. or First class M.Sc degree in Bioinformatics or Biotechnology/life science with specialization in Bioinformatics.

Fellowships: Rs 22,000/- with HRA for PhD qualified, Rs 16000/- with HRA for NET/BET/BINC/GATE qualified and 12000/- with HRA for non NET qualified applicants.

Interested candidates may send their complete biodata along with a write-up of their experience and suitability for the position to Dr. Dinesh Gupta by email only to dinesh@icgeb.res.in within 15 days of publication of this advertisement. Kindly mark the email with subject “Application for BIF-RA-2013”

Closing date for applications: 18 October 2013

Only short listed candidates will be invited for an interview at ICGEB.

No TA/DA will be paid for attending the interview.

Advertisement: http://www.icgeb.org/tl_files/Vacancies/BIF-RA-Advt.pdf

Applications on plain paper along with details of CV (relevant photocopies of their
qualifications/experience and reprints of published work to be attached) are invited from qualified candidates for Research Fellowship in CSIR- sponsored research project.

JRF/SRF/RA (one vacancy)

CSIR sponsored “In silico design, identification and in vitro validation of lead molecule inhibitors to Bcr-Abl kinase”

JRF: M.Sc in Chemistry/ Bioinformatics/ Biotechnology with I division and NET or GATE qualified

SRF: M.Sc in chemistry/ Bioinformatics/ Biotechnology with at least two years of post- M.Sc research experience as evidenced from published papers in standard refereed journals in relevant area

RA: PhD in chemistry/ Bioinformatics/ Biotechnology with research experience in
relevant area.

As per CSIR guidelines

Notes:
1) You may visit the University of Hyderabad website www.uohyd.ernet.in to learn more about the University of Hyderabad.
2) Applicants should note that the appointment to be made is purely temporary and there is no right for claiming for any regular appointment in the University.
3) No TA/DA will be paid for attending the interview or at the time of joining the post, if selected.
4) The application should be submitted by post/courier/in-person to the address given below on or before November 1st 2013.

Prof. Lalitha Guruprasad
W-103, Gurbakhsh Singh Building
School of Chemistry
University of Hyderabad
Hyderabad- 500 046
5) Short-listed candidates will be called for interview at a short notice.

Advertisement: http://www.uohyd.ac.in/images/recruitment/chemisry_advt_101013.pdf

Core_nt contains the same eukaryotic transcript and gene-related sequences as nt. The core_nt database is nt without most eukaryotic chromosome sequences. Most nucleotide BLAST searches with core_nt will be similar to the nt database. However, core_nt is better than nt for accomplishing your most common BLAST search goals, such as identifying gene-related sequences like transcript sequences and complete bacterial chromosomes. This is because, in recent years, nt has acquired more low-relevance, non-annotated, and non-gene content. 

Learn more: https://ncbiinsights.ncbi.nlm.nih.gov/2024/07/18/new-blast-core-nucleotide-database/

Available immediately until 30th November 2015, to work on the development of bioinformatics approaches to aid analysis of data derived from the metabolomic profiling of biological matrices. The successful applicant will lead research activities on an FP7 funded EU-wide collaborative project aimed at establishing biomarker-based strategies for high throughput diagnostic screening. Key tasks will involve multivariate analysis of large datasets, bioinformatic-based selection and validation of identified markers, construction of metabolomic spectral profile databases and development of machine learning/database searching approaches amenable to analytical screening techniques. This position will offer the opportunity to travel and undertake work with project collaborators based in the Republic of Ireland and Europe.

Informal enquiries may be directed to Dr Terry McGrath, email: terry.mcgrath@qub.ac.uk.

Anticipated interview date: Thursday 31st October 2013
Salary scale: £30,424 – £39,649 per annum (including contribution points)
Closing date: Monday 21st October 2013

Telephone (028) 90973044 FAX: (028) 90971040 or e-mail on personnel@qub.ac.uk

The University is committed to equality of opportunity and to selection on merit. It therefore welcomes applications from all sections of society and particularly welcomes applications from people with a disability.

Fixed term contract posts are available for the stated period in the first instance but in particular circumstances may be renewed or made permanent subject to availability of funding.

More @ https://hrwebapp.qub.ac.uk/tlive_webrecruitment/wrd/run/ETREC107GF.open?VACANCY_ID=5616943npO&WVID=6273090Lgx&LANG=USA

A fairly complete on-line guide to BLAST searching can be found at the NCBI BLAST Help Manual. For a theoretical overview of BLAST, see the NCBI BLAST Course. Additional information can be found in the BLAST 2.0 Release Notes

Supported and Suggested Values for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX

Address of the bookmark: https://www.arabidopsis.org/Blast/BLASToptions.jsp

(INDIAN COUNCIL OF MEDICAL RESEARCH)

P.O BOX 101,
Dr. M. Miyazaki Marg,
Tajganj, Agra - 282001

Applications are invited for a walk-in interview to be held in the Seminar Hall of the on 15th November, 2013, 9:30 am for temporary positions of JRF, Lab Technician and Field attendant in a ICMR funded project entitled "Elucidating the strain differentiation and transmission dynamics of M. leprae through simple sequence repeats ISSR-PCR marker"

1. JRF (one Post)

Essential qualification: Candidates with M.Sc/IVI.Tech or equivalent degree in any life science related subjects with UGC-CSIR/ICMR/DBT-Net qualified

Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.

Age. Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.

Emoluments: Rs. 6,000 + 20% HRA per Month

2. Lab Technician (One Post)

Essential Qualification: 12th with DMLT/B.SCA4.SC in Life sciences

Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.

Age: Maximum 30 years as on 11.11.2013. Age relaxation as per GOI rules.

Emoluments: Rs13,760/ Per Month

3. Field Attendant (One Post)

Essential Qualification: 10th Pass

Desirable Qualification: Experience in field work

Age: Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.

Emoluments: Rsl2,040l Per Month

Terms: posts are purely temporary. Appointment will be initially made for a period of one (01) year and may be extended further based on the performance of the candidate up to completion of the project.

Application & Selection procedure: candidates have to appear in the walk-in-interview in person along with an application/CV on plain paper giving details of at educational qualificationq experience and submit photocopies of relevant documents at the time of interview. Selection will be based on the performance of the candidate in the interview' Candidates will not be sent any interview call letter separately. No TA/DA will be paid to the candidate for appearing in the interview. selection is not possible without appearing in the interview. All candidates must report by 9:00am on the date of interview. Advance copy of CV may be sent to m.sarathipartha@gmail.com

Advertisement: http://www.jalma-icmr.org.in/P_S_M_advertisment.pdf

Check out the changes they made.

They added the cleanup-blastdb-volumes.py script to remove unused BLAST database volumes. Read the documentation here.

They also switched the protocol from ftp to https to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the update_blastdb.pl script.

And fixed a few bugs related to downloading data from the NCBI, and mt_mode crashing blastn and blastx.

Check out the release notes.

Download BLAST+ 2.14.1

Questions or comments? Please write the BLAST help desk.

More info and download: https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html

Deadline for applications : January 15, 2014.

Description :

We seek a talented and motivated post-doc to develop computational methods for inferring the molecular basis of genetic diseases by integration of personal omics data. Research topics include: identifying causal mutations of rare disease patients by meta-analysis; inferring disease-causing molecular pathways from genotype, human phenotypes, and omics profile of patient-derived cell lines; and causal inference from longitudinal omics studies of patients. The developed methods will be applied to analyze data from our medical collaborators.

Candidates must either hold a PhD in computational biology or bioinformatics, or hold a PhD in physics, statistics, or applied mathematics with practical experience with high-dimensional data analysis. Experience in quantitative genetics is a plus. Applicants must have a proven publication record and an interest for translational research.

The Gagneur lab is a young, lively and multidisciplinary group with a research focus on systems genetics and gene regulation. It is located at the Gene Center of the LMU (University of Munich), an interdisciplinary institution whose 16 independent research groups investigate the regulation of gene expression at all levels - from the underlying molecular mechanisms to the biological system. The institute is located on the biomedical research campus Munich-Grosshadern, offering a dynamic, interactive and internationally oriented research environment. The dynamism of Munich and the proximity of the Alps provide an excellent quality of life.

The salary is according to the TV-L (German academic salary scale).
Applications including a cover letter, CV, and references must be sent by January 15th 2014 to Julien Gagneur (gagneur@genzentrum.lmu.de)

About the lab: http://www.gagneur.genzentrum.lmu.de

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!