BOL: Related items

Genobuntu: Package for Next Generation Sequencing and Genome Assembly

BioStar — Mon, 18 May 2020 16:47:56 -0500

Genobuntu is a software package containing more than 70 software and packages oriented towards NGS. In its current version, Genobuntu supports pre assembly tools, genome assemblers as well as post assembly tools.

Commonly used biological software and example script files for different assembly pipelines have also been provided, where the example script files can be updated to suit one’s experimental needs. Genobuntu attempts to reduce the amount of time and energy needed to build software workstations and it can also act as a good teaching source for a class room setting.

Therefore, Genobuntu offers a well-tailored environment for both novices and experts working in the field of genome assembly.

Features

Velvet
MiB
SSAKE
EULER
VCAKE
ABySS
ALLPATHS
Celera
SHARCGS
Allpaths
IDBA
TAIPAN
Edena
SOAPdenovo
Maq
IDBA-UD
No. of Reads present in the Ref. Seq.
ART NGS Reads Simulator
HiTEC, FASTQC
Minimum Description Length
SOAPaligner
Sequencing Read Archive Toolkit

Address of the bookmark: https://sourceforge.net/projects/genobuntu/

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

MitoFinder

Neel — Tue, 29 Aug 2023 02:13:01 -0500

Allio, R., Schomaker-Bastos, A., Romiguier, J., Prosdocimi, F., Nabholz, B., & Delsuc, F. (2020) Mol Ecol Resour. 20, 892-905. (publication link)

Mitofinder is a pipeline to assemble mitochondrial genomes and annotate mitochondrial genes from trimmed read sequencing data.

MitoFinder is also designed to find and annotate mitochondrial sequences in existing genomic assemblies (generated from Hifi/PacBio/Nanopore/Illumina sequencing data...)

MitoFinder is distributed under the license.

Address of the bookmark: https://github.com/RemiAllio/MitoFinder

Reference Sequence Resource!

LEGE — Wed, 15 Sep 2021 21:15:22 -0500

The ENCODE project uses Reference Genomes from NCBI or UCSC to provide a consistent framework for mapping high-throughput sequencing data. In general, ENCODE data are mapped consistently to 2 human (GRCH38, hg19) and 2 mouse (mm9/mm10) genomes for historical comparability. Drosophia melanogaster experiments are mapped to either dm3 or dm6 and Caenorhabdilis elegans experiments are mapped to ce10 or ce11. T

Address of the bookmark: https://www.encodeproject.org/data-standards/reference-sequences/

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Peregrine & SHIMMER Genome Assembly Toolkit

Abhi — Thu, 16 Dec 2021 02:50:19 -0600

Peregrine is a fast genome assembler for accurate long reads (length > 10kb, accuracy > 99%). It can assemble a human genome from 30x reads within 20 cpu hours from reads to polished consensus. It uses Sparse HIereachical MimiMizER (SHIMMER) for fast read-to-read overlaping without quadratic comparisions used in other OLC assemblers.

Address of the bookmark: https://github.com/cschin/Peregrine

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Comparative Genomics Workshops !

Rahul Nayak — Tue, 25 Jan 2022 20:39:58 -0600

This meeting's objective was to obtain a big picture look at the current state of the field of comparative genomics with a focus on commonalities across genomic investigations into humans, model organisms (both traditional and non-traditional), agricultural species, wildlife species and microbes.

https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Address of the bookmark: https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Environmental Genomics Group SciLifeLab/KTH Stockholm

BioStar — Thu, 01 Dec 2022 01:12:43 -0600

Useful Metagenomics resources

Address of the bookmark: https://github.com/envgen