Address of the bookmark: https://gvolante.riken.jp/

The Genome Informatics Section is hiring! Come join our outstanding team at the NIH’s National Human Genome Research Institute and contribute to the development of new reference genomes and computational methods for DNA sequencing and analysis. Both postdoc and PhD students positions are available. More information and application instructions follow below.

More at https://genomeinformatics.github.io/

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Genobuntu is a software package containing more than 70 software and packages oriented towards NGS. In its current version, Genobuntu supports pre assembly tools, genome assemblers as well as post assembly tools.

Commonly used biological software and example script files for different assembly pipelines have also been provided, where the example script files can be updated to suit one’s experimental needs. Genobuntu attempts to reduce the amount of time and energy needed to build software workstations and it can also act as a good teaching source for a class room setting.

Therefore, Genobuntu offers a well-tailored environment for both novices and experts working in the field of genome assembly.

Address of the bookmark: https://sourceforge.net/projects/genobuntu/

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Mitofinder is a pipeline to assemble mitochondrial genomes and annotate mitochondrial genes from trimmed read sequencing data.

MitoFinder is also designed to find and annotate mitochondrial sequences in existing genomic assemblies (generated from Hifi/PacBio/Nanopore/Illumina sequencing data...)

MitoFinder is distributed under the license.

Address of the bookmark: https://github.com/RemiAllio/MitoFinder

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Address of the bookmark: https://www.encodeproject.org/data-standards/reference-sequences/