More at sandbox.bio

Address of the bookmark: http://sandbox.bio

No of vacancies: 01

Pay scale:Rs. 15600 – 39100 + 6600/-

Essential Academic Qualifications / Experience : Good academic record as defined by the concerned university with at least 55% marks (or an equivalent grade in a point scale wherever grading system is followed) at the Master's Degree level in a relevant subject from an Indian University, or an equivalent degree from an accredited foreign university.

Besides fulfilling the above qualifications, the candidate must have cleared the National Eligibility Test (NET) conducted by the UGC, CSIR or similar test accredited by the UGC like SLET/ SET.

Notwithstanding anything contained in sub-clauses (a) and (b) to this Clause, candidates, who are, or have been awarded a Ph.D. Degree in accordance with the University Grants Commission (Minimum Standards and Procedure for Award of Ph.D. Degree) Regulations, 2009, shall be exempted from the requirement of the minimum eligibility condition of NET/SLET/SET for recruitment and appointment of Assistant Professor or equivalent positions in Universities/Colleges/Institutions.

NET/SLET/SET shall also not be required for such Masters Programmes in disciplines for which NET/SLET/SET is not conducted.

Apply online: http://www.psc.cg.gov.in/htm/OA_ME2014.html

Last Date for Online Registration: 22/05/2014

For more details: http://www.psc.cg.gov.in/pdf/Advertisement/ADV_ME2014.pdf

• In a GitHub or GitLab repository
• Free to use
• Written in markdown or similar

NOTE: This list of courses is selected only based on the above criteria.
There are no checks on quality.

https://glittr.org/?per_page=25&sort_by=stargazers&sort_direction=desc

Address of the bookmark: https://glittr.org/?per_page=25&sort_by=stargazers&sort_direction=desc

1. NCBI (National Center for Biotechnology Information):

   • NCBI provides various databases related to genetic information, including 16S rRNA sequences.
   • You can access the 16S ribosomal RNA sequences from NCBI's Nucleotide database (https://www.ncbi.nlm.nih.gov/nucleotide/).
   • Perform a search using keywords like "16S rRNA" or specific bacterial names to find relevant sequences.
   • You can download sequences individually or in batches using the provided tools.

2. GreenGenes:

   • GreenGenes is a widely used 16S rRNA gene sequence database.
   • You can access it at http://greengenes.secondgenome.com/.
   • GreenGenes provides precompiled databases for various purposes, including classification, alignment, and phylogenetic analysis.

3. SILVA:

   • SILVA (https://www.arb-silva.de/) is another comprehensive database for ribosomal RNA (rRNA) sequences.
   • It covers not only 16S rRNA but also other ribosomal RNA sequences.
   • SILVA provides precompiled databases for various purposes, including taxonomic classification and alignment.

4. Ribosomal Database Project (RDP):

   • RDP (http://rdp.cme.msu.edu/) is a curated database that offers 16S rRNA sequences.
   • It provides tools for sequence analysis and classification.
   • You can download sequences and taxonomy information from their website.

5. QIIME (Quantitative Insights Into Microbial Ecology):

   • QIIME (https://qiime2.org/) is a widely used bioinformatics platform for microbiome analysis.
   • It provides tools for analyzing microbial communities, including processing 16S rRNA sequences.
   • QIIME often includes its own preprocessed 16S rRNA databases that can be used for analysis within the platform.

Before downloading any database, make sure to read the terms of use and citation requirements, as some databases may have specific usage policies. Additionally, consider the compatibility of the database with your analysis pipeline and software tools.

NCBI 16s RNA database location ftp://ftp.ncbi.nih.gov/blast/db/16SMicrobial.tar.gz

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

ICRISAT seeks applications from Indian nationals Visiting Scientist-Computational Genomics (2 positions), to be part of a team of Centre of Excellence in Genomics (CEG), (www.icrisat.org/ceg) to work on legume genomics projects. The positions will be based at ICRISAT’s Headquarters in Patancheru, Hyderabad, India.

ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these are the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture. ICRISAT is headquartered in Greater Hyderabad, Andhra Pradesh, India and belongs to the Consortium of Centers supported by the Consultative Group on International Agricultural Research (CGIAR).

The Job: Responsibilities for these positions include:

Analyzing and handling large-scale next generation sequencing DNA and RNA data
Data mining and development of pipelines and troubleshooting
Genome diversity analysis such as SNPs, Indels, Structural Variations, population structure
Genome wide association study (GWAS) related analysis- LD analysis, hapmap and trait mapping
Expression analysis based on RNA-Seq data, annotation, gene ontology and metabolic pathway analysis
Epigenome analysis, small RNA identification
Gene family analysis, sequence level protein analysis, orthology/paralogy and molecular modelling
Compiling and analysis of results, writing reports and research papers

The Person: Ph.D. or MSc/MTech/PGDCA with two years research experience in Biotechnology, Computational biology, Agricultural/ Plant Biotechnology, Genetics, Molecular Biology or related discipline. Good knowledge of programming/scripting in at least two of following languages: Perl, C, C++, R, Shell Scripting and Python is plus.

How to apply: Please apply latest by 20 July 2014. The application should include the name of the position applied for, a letter of motivation, a full Curriculum Vita (CV), and the names and contact information of three references that are knowledgeable of the candidate’s professional qualifications and work experience. Technical details and more information about these positions can be obtained from R.K.VARSHNEY@CGIAR.ORG. All applications will be acknowledged, however only short listed candidates will be contacted.

Apply here https://recruit.zoho.com/ats/Portal.na?digest=T642sgLYWZOStExJ77cPrcM*sIMGZETWw4yPxngbmHA-

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

Address of the bookmark: http://www.programmingr.com/category/stype/r-job-listings/