BOL: Related items

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

GPS DNA tracking - University of Sheffield

Sat, 10 May 2014 04:33:28 -0500

University of Sheffield geneticist and bioinformatics expert Dr Eran Elhaik demonstrates the power of his new DNA research, which allows people to discover their genetic homeland from 1000 years ago. Find out more about our biological research here http://www.sheffield.ac.uk/aps

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

Jit — Wed, 14 Nov 2018 04:50:27 -0600

MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5. MEGAHIT v1.0 or greater also supports IBM Power PC and has been tested on IBM POWER8.

https://academic.oup.com/bioinformatics/article/31/10/1674/177884

Address of the bookmark: https://github.com/voutcn/megahit

Visiting Scientist - Computational Genomics (two positions)

Mon, 07 Jul 2014 22:53:41 -0500

Scientific/Managerial & International Recruitment

ICRISAT seeks applications from Indian nationals Visiting Scientist-Computational Genomics (2 positions), to be part of a team of Centre of Excellence in Genomics (CEG), (www.icrisat.org/ceg) to work on legume genomics projects. The positions will be based at ICRISAT’s Headquarters in Patancheru, Hyderabad, India.

ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these are the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture. ICRISAT is headquartered in Greater Hyderabad, Andhra Pradesh, India and belongs to the Consortium of Centers supported by the Consultative Group on International Agricultural Research (CGIAR).

The Job: Responsibilities for these positions include:

Analyzing and handling large-scale next generation sequencing DNA and RNA data
Data mining and development of pipelines and troubleshooting
Genome diversity analysis such as SNPs, Indels, Structural Variations, population structure
Genome wide association study (GWAS) related analysis- LD analysis, hapmap and trait mapping
Expression analysis based on RNA-Seq data, annotation, gene ontology and metabolic pathway analysis
Epigenome analysis, small RNA identification
Gene family analysis, sequence level protein analysis, orthology/paralogy and molecular modelling
Compiling and analysis of results, writing reports and research papers

The Person: Ph.D. or MSc/MTech/PGDCA with two years research experience in Biotechnology, Computational biology, Agricultural/ Plant Biotechnology, Genetics, Molecular Biology or related discipline. Good knowledge of programming/scripting in at least two of following languages: Perl, C, C++, R, Shell Scripting and Python is plus.

How to apply: Please apply latest by 20 July 2014. The application should include the name of the position applied for, a letter of motivation, a full Curriculum Vita (CV), and the names and contact information of three references that are knowledgeable of the candidate’s professional qualifications and work experience. Technical details and more information about these positions can be obtained from R.K.VARSHNEY@CGIAR.ORG. All applications will be acknowledged, however only short listed candidates will be contacted.

Apply here https://recruit.zoho.com/ats/Portal.na?digest=T642sgLYWZOStExJ77cPrcM*sIMGZETWw4yPxngbmHA-

GraphUnzip: Phases an assembly graph using Hi-C data and/or long reads.

Jit — Fri, 05 Feb 2021 21:22:24 -0600

GraphUnzip, a fast, memory-efficient and accurate tool to unzip assembly graphs into their constituent haplotypes using long reads and/or Hi-C data. As GraphUnzip only connects sequences in the assembly graph that already had a potential link based on overlaps, it yields high-quality gap-less supercontigs. To demonstrate the efficiency of GraphUnzip, we tested it on a simulated diploid Escherichia coli genome, and on two real datasets for the genomes of the rotifer Adineta vaga and the potato Solanum tuberosum. In all cases, GraphUnzip yielded highly continuous phased assemblies.

https://www.biorxiv.org/content/biorxiv/early/2021/02/01/2021.01.29.428779.full.pdf

Address of the bookmark: https://github.com/nadegeguiglielmoni/GraphUnzip

R programming and Jobs website

Pragati Singh — Sun, 25 May 2014 14:43:57 -0500

Welcome to the R Jobs section of ProgrammingR.com. If your organization has an R employment opportunity that you would like to have posted here, submit it via the contact page. Prospective employees: use the contact information provided in the position listing to apply or contact the hiring organization.

Address of the bookmark: http://www.programmingr.com/category/stype/r-job-listings/

GraphPath: A graph attention model for molecular stratification with interpretability based on the pathway-pathway interaction network

LEGE — Wed, 27 Mar 2024 20:51:21 -0500

Achieving accurate and interpretable clinical predictions requires paramount attention to thoroughly characterizing patients at both the molecular and biological pathway levels. In this paper, we present GraphPath, a biological knowledge-driven graph neural network with multi-head self-attention mechanism that implements the pathway-pathway interaction network. We train GraphPath to classify the cancer status of patients with prostate cancer based on their multi-omics profiling.

Address of the bookmark: https://github.com/amazingma/GraphPath

The Human Genome Project Video 3D Animation Introduction Low)

Sat, 24 Aug 2013 19:01:19 -0500

Stephen Friend: The hunt for "unexpected genetic heroes"

Sat, 31 May 2014 14:31:47 -0500

What can we learn from people with the genetics to get sick — who don't? With most inherited diseases, only some family members will develop the disease, while others who carry the same genetic risks dodge it. Stephen Friend suggests we start studying those family members who stay healthy. Hear about the Resilience Project, a massive effort to collect genetic materials that may help decode inherited disorders. TEDTalks is a daily video podcast of the best talks and performances from the TED Conference, where the world's leading thinkers and doers give the talk of their lives in 18 minutes (or less). Look for talks on Technology, Entertainment and Design -- plus science, business, global issues, the arts and much more. Find closed captions and translated subtitles in many languages at http://www.ted.com/translate Follow TED news on Twitter: http://www.twitter.com/tednews Like TED on Facebook: https://www.facebook.com/TED Subscribe to our channel: http://www.youtube.com/user/TEDtalksDirector