We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

BBSplit is a tool that bins reads by mapping to multiple references simultaneously, using BBMap. The reads go to the bin of the reference they map to best. There are also disambiguation options, such that reads that map to multiple references can be binned with all of them, none of them, one of them, or put in a special "ambiguous" file for each of them. Paired reads will always be kept together.

For example, if you had a library of something that was contaminated with e.coli and salmonella, you could do this:

bbsplit.sh in=reads.fq ref=ecoli.fa,salmonella.fa basename=out_%.fq outu=clean.fq int=t

This will produce 3 output files:
out_ecoli.fq (ecoli reads)
out_salmonella.fq (salmonella reads)
clean.fq (unmapped reads)

In this case, "int=t" means that the input file is paired and interleaved. For single-end reads you would leave that out. For paired reads in 2 files, you would do this:
bbsplit.sh in1=reads1.fq in2=reads2.fq ref=ecoli.fa,salmonella.fa basename=out_%.fq outu1=clean1.fq outu2=clean2.fq

BBSplit is available here:
https://sourceforge.net/projects/bbmap/

The sensitivity can be raised to be equivalent to BBMap with these flags: "minratio=0.56 minhits=1 maxindel=16000"

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

https://www.hindawi.com/journals/ijpg/2011/373875/

Address of the bookmark: https://sourceforge.net/projects/cvit/

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Address of the bookmark: https://www.bioconductor.org/packages/devel/bioc/vignettes/QuasR/inst/doc/QuasR.html

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

FIGENO is a
  FIGure
    GENerator
for GENOmics

With figeno, you can plot various types of sequencing data along genomic coordinates. Video overview: https://www.youtube.com/watch?v=h1cBeXoSYTA.

Address of the bookmark: https://github.com/CompEpigen/figeno

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Common uses of the tool include:

• Displaying the sequence and/or genes in a GenBank flat file.
• Highlighting differences and/or similarities in gene content between related organisms.
• Comparing SNPs and indels between closely-related strains or serovars.
• Comparing gene expression values across multiple samples or timepoints.
• Visualizing coverage plots of RNA-Seq read alignments.

Key Features

Circleator...

• Builds on BioPerl and the input file formats that it supports, including:
  • GenBank flat files, GFF, FASTA
• Accepts a number of other commonly-used datatypes and file formats:
  • BSR and TRF output, SAM/BAM files, VCF-encoded SNPs, tab-delimited files
• Outputs publication-ready figures in the SVG (Scalable Vector Graphics) format.
• Requires only a single configuration file whose layout mirrors that of the figure itself.
  • Predefined configuration files and "track" types are supplied for common datasets.
  • Advanced features allow limited analyses to be performed as a figure is drawn.
• Includes an extensive set of regression tests.
• Offers a prototype web-based GUI (under the "Ringmaster" project.)

https://github.com/jonathancrabtree/Circleator

Address of the bookmark: https://github.com/jonathancrabtree/Circleator