We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

A recent study by Webster and Chapman introduces Buscogeny (https://github.com/Jwebster89/Buscogeny), an open-source bioinformatics pipeline designed to make this process easier. The tool uses BUSCO (Benchmarking Universal Single-Copy Orthologs), which identifies conserved genes that are expected to occur as single copies in particular groups of organisms. These genes act like evolutionary landmarks, allowing researchers to compare genomes and investigate their relationships.

Buscogeny brings several steps of phylogenomic analysis into one workflow. It identifies BUSCO genes, extracts and aligns their sequences, removes unreliable regions, combines information from multiple genes, and uses the resulting data to construct a phylogenetic tree. It also provides quality-control information, helping researchers identify genomes that may be too incomplete for reliable analysis.

The authors demonstrate the usefulness of Buscogeny with bacterial and fungal genomes, including Alternaria. This is particularly valuable because fungal genomes can vary greatly in quality and annotation. Ultimately, Buscogeny helps transform massive amounts of genomic data into an understandable evolutionary story. Each DNA sequence becomes a clue, each conserved gene becomes a landmark, and together these clues reveal a picture of how life is connected.

More at https://link.springer.com/article/10.1007/s10123-025-00752-6?

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

R script that makes a plotly interactive and/or static (png/pdf) dot plot.

Shiny app available for testing

Address of the bookmark: https://github.com/tpoorten/dotPlotly

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

More recently, we've been enthused about using k-mer based similarity measures and computing and searching k-mer-based sketch search databases for all the things.

But I haven't spent too much talking about using k-mers for taxonomy, although that has become an ahem area of interest recently, if you read into our papers a bit.

In this blog post I'm going to fix this by doing a little bit of a literature review and waxing enthusiastic about other people's work. Then in a future blog post I'll talk about how we're building off of this work in fun! and interesting? ways!

Address of the bookmark: http://ivory.idyll.org/blog/2017-something-about-kmers.html

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Address of the bookmark: https://practical-stats-med-r.netlify.app/

BBSplit is a tool that bins reads by mapping to multiple references simultaneously, using BBMap. The reads go to the bin of the reference they map to best. There are also disambiguation options, such that reads that map to multiple references can be binned with all of them, none of them, one of them, or put in a special "ambiguous" file for each of them. Paired reads will always be kept together.

For example, if you had a library of something that was contaminated with e.coli and salmonella, you could do this:

bbsplit.sh in=reads.fq ref=ecoli.fa,salmonella.fa basename=out_%.fq outu=clean.fq int=t

This will produce 3 output files:
out_ecoli.fq (ecoli reads)
out_salmonella.fq (salmonella reads)
clean.fq (unmapped reads)

In this case, "int=t" means that the input file is paired and interleaved. For single-end reads you would leave that out. For paired reads in 2 files, you would do this:
bbsplit.sh in1=reads1.fq in2=reads2.fq ref=ecoli.fa,salmonella.fa basename=out_%.fq outu1=clean1.fq outu2=clean2.fq

BBSplit is available here:
https://sourceforge.net/projects/bbmap/

The sensitivity can be raised to be equivalent to BBMap with these flags: "minratio=0.56 minhits=1 maxindel=16000"