https://www.hindawi.com/journals/ijpg/2011/373875/

Address of the bookmark: https://sourceforge.net/projects/cvit/

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Address of the bookmark: https://www.bioconductor.org/packages/devel/bioc/vignettes/QuasR/inst/doc/QuasR.html

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

FIGENO is a
  FIGure
    GENerator
for GENOmics

With figeno, you can plot various types of sequencing data along genomic coordinates. Video overview: https://www.youtube.com/watch?v=h1cBeXoSYTA.

Address of the bookmark: https://github.com/CompEpigen/figeno

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Common uses of the tool include:

• Displaying the sequence and/or genes in a GenBank flat file.
• Highlighting differences and/or similarities in gene content between related organisms.
• Comparing SNPs and indels between closely-related strains or serovars.
• Comparing gene expression values across multiple samples or timepoints.
• Visualizing coverage plots of RNA-Seq read alignments.

Key Features

Circleator...

• Builds on BioPerl and the input file formats that it supports, including:
  • GenBank flat files, GFF, FASTA
• Accepts a number of other commonly-used datatypes and file formats:
  • BSR and TRF output, SAM/BAM files, VCF-encoded SNPs, tab-delimited files
• Outputs publication-ready figures in the SVG (Scalable Vector Graphics) format.
• Requires only a single configuration file whose layout mirrors that of the figure itself.
  • Predefined configuration files and "track" types are supplied for common datasets.
  • Advanced features allow limited analyses to be performed as a figure is drawn.
• Includes an extensive set of regression tests.
• Offers a prototype web-based GUI (under the "Ringmaster" project.)

https://github.com/jonathancrabtree/Circleator

Address of the bookmark: https://github.com/jonathancrabtree/Circleator

Background

The identification of chromosomal homologous segments (CHS) within and between genomes is essential for comparative genomics. Various processes including insertion/deletion and inversion could cause the degeneration of CHSs.

Address of the bookmark: https://almob.biomedcentral.com/articles/10.1186/1748-7188-4-2

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

Address of the bookmark: https://github.com/pratas/smash