BOL: Related items

Search Shell Command History

Rahul Nayak — Thu, 12 Jun 2014 17:43:34 -0500

We use couple of hundreads of command in daily basis. Most of them are actually repeated several time. The question remain open how do I search old command history under bash shell and modify or reuse it?

Now a days almost all modern shell allows you to search command history if enabled by user. Use history command to display the history list with line numbers. Lines listed with with a * have been modified by user.

Shell history search command

Type history at a shell prompt:
$ history

It will display the list of all used commandline history with an serial number.

To search particular command, enter:
$ history | grep command-name
$ history | egrep -i 'scp|ssh|ftp'
Emacs Line-Edit Mode Command History Searching

To get previous command containing string, hit [CTRL]+[r] followed by search string:

(reverse-i-search):

To get previous command, hit [CTRL]+[p]. You can also use up arrow key.

CTRL-p

To get next command, hit [CTRL]+[n]. You can also use down arrow key.

CTRL-n

fc command

Apart from hostory command there are fc command to extract the command from history. The fc stands for either "find command" or "fix command.

For example list last 10 command, enter:
$ fc -l 10
To list commands 130 through 150, enter:
$ fc -l 130 150
To list all commands since the last command beginning with ssh, enter:
$ fc -l ssh
You can edit commands 1 through 5 using vi text editor, enter:
$ fc -e vi 1 5

Delete command history

The -c option causes the history list to be cleared by deleting all of the entries:
$ history -c

CrossMap: a program for convenient conversion of genome coordinates

Jit — Thu, 31 May 2018 06:00:47 -0500

CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) <> hg19 (GRCh37), Mouse mm9 (MGSCv37) <> mm10 (GRCm38)). It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF. CrossMap is designed to liftover genome coordinates between assemblies. It’s not a program for aligning sequences to reference genome. We do not recommend using CrossMap to convert genome coordinates between species.

Address of the bookmark: http://crossmap.sourceforge.net

Bioinformatician’s Pocket Reference !!

RAJESH DETROJA — Sun, 08 Jun 2014 09:56:58 -0500

It is amusing how brain of bioinformaticians work! Learning a new programming language for days feels so much of fun that making 5 minute discussion with neighbours (unless under special circumstances!) in our own mother-tongue. Today every bioinformatician keeps more than few languages and core IT toolkits on their plate. It has become mandatory to be able to mould different code snippets to build our own custom workflows, and thus keeping syntax at our fingertips has become essential.Although Google is best way to get syntax problem solved, it is not a bad idea to keep reference sheets is our smartphones or stick out some printed sheets on the back of your door, in the old fashion way!!

Address of the bookmark: http://infoplatter.wordpress.com/2014/04/06/bioinformaticians-pocket-reference/

assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome

Jit — Thu, 14 Jun 2018 07:31:00 -0500

Download and install MUMmer Align your assembly to a reference genome using nucmer (from MUMmer package) $ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT Consult the MUMmer manual if you encounter problems Optional: Gzip the delta file to speed up upload (usually 2-4X faster) $ gzip OUT.delta Then use the OUT.delta.gz file for upload. Upload the .delta or delta.gz file (view example) to Assemblytics Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference. The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment. http://assemblytics.com/

Address of the bookmark: http://assemblytics.com/

Assistant Professor in Medical Bioinformatics

Tue, 24 Jun 2014 01:46:36 -0500

Advt. No : ME-I/A-IV/03/14
No.of Posts:01 (SC)
Pay Scale:
Pay Band of Rs.15600-39100 + Rs.6000/- GP +NPA @ 25% of Basic Pay +Learning Resource Allowance @ Rs.20,000/-P.A.+ Conveyance Allowance @ Rs. 1650/-P.M.+ Academic Allowance @ Rs.2500/- P.M. and other admissible allowances.
Qualifications:
Area of Specialization:-
Bioinformatics/Computational/Biology/Genomics/ Proteomics/ Structural Biology
1. Postgraduate qualification, e.g. Master’s Degree in Biotechnology/Bioinformatics/ Biophysics.
2. A Doctorate Degree of recognized University/Institute in a basic or allied Medical Science subject e.g. Medical Biotechnology/Biophysics. Bioinformatics/X-ray Crystallography/
Immunology/Structural Biology etc
Experience:
1.Minimum three years teaching and/or research experience in a recognized medical/research Institution in an allied medical subject after obtaining doctorate degree and preferably in Medical
Molecular Biology/ Biophysics/Structural Biology/Genomics and Clinical Proteomics/Computational Biology.
2. Minimum two publication with atleast one in international journal and atleast one as first author
Desirable:-
Consistently excellent scholastic/academic record, demonstrated ability to write grant proposal/(s) successfully, Post Doctoral training in a frontier area of medical Bioinformatics Research and of direct relevance to clinical diagnosis or patient care (preferably from a recognized top-ranking medical institution abroad)
Send your applications to O/O, Deputy Registrar, Recruitment & Establishment Cell, University of Health Sciences, Rohtak by 08.7.2014
For more details,please visit website: http://pgimsrohtak.nic.in/2014%20AP%20Advt.pdf
Last Apply Date: 08 Jul 2014

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Postdoc position at Centre Méditerranéen de Médecine Moléculaire

Sun, 06 Jul 2014 11:23:06 -0500

The research group of Dr. Michele Trabucchi at the Centre Méditerranéen de Médecine Moléculaire (C3M) at INSERM U1065 (University of Nice Sophia-Antipolis, France) is seeking candidates for a Postdoctoral fellow position to start on October 2014 for 3 years funded by FRM (Fondation pour la Recherche Médicale).
The broad interest of the lab is in understanding the expression control and function of small RNAs in activated myeloid cells (visit our webpage to check research interests and publications of the group : http://www.unice.fr/c3m/EN/Equipe10.html ).

The work will focus on the functional studies of small RNAs by using next-generation sequencing approaches.

Candidates should hold a Ph.D. degree and have strong background in bioinformatics.
The University of Nice Sophia-Antipolis provides a wide range of facilities and training essential for biomedical research.
Interested applicants should send a PDF with a cover letter stating research interests and qualifications, an updated CV, a summary of previous research experience and contact information for two references to Michele Trabucchi ( mtrabucchi@unice.fr )

GFinisher: a new strategy to refine and finish bacterial genome assemblies

Jit — Thu, 26 Jul 2018 09:31:55 -0500

GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.

java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory

Address of the bookmark: http://gfinisher.sourceforge.net

Pimp your brain: Bioinformatics

Wed, 20 Aug 2014 22:09:21 -0500

Jan Lisec from the Max Planck Institute of Molecular Plant Physiology explains, in this "pimp your brain" episode, what bioinformatics is and why bioinformatics is so important and indispensable for biological research. In the video serial "Pimp your brain" scientists from the Max Planck Institute of Molecular Plant Physiology describe their research. More videos from the 'Pimp your brain' serial are available on www.youtube.com/playlist?list=PL-l9VItC9Gn2Ur2Xj6PTOAkjLUlVPbIOO More videos are available on www.mpimp-golm.mpg.de

Center for Molecular Dynamics Nepal (CMDN), Nepal

Wed, 23 Jul 2014 13:54:51 -0500

Center for Molecular Dynamics Nepal (CMDN), established 2007 prides itself as a research driven nongovernmental organization. Unlike other civil society organizations, CMDN is dedicated entirely to promoting research in the country. With its team of energetic and highly motivated experts, CMDN is now recognized as the leading public health and wildlife research organization of the country.

More at http://www.cmdn.org.np/main/index.php