<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31976?offset=10</link>
	<atom:link href="https://bioinformaticsonline.com/related/31976?offset=10" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/1720/postdoctoral-associate-bioinformatics-at-duke-university-medical-center</guid>
  <pubDate>Sat, 10 Aug 2013 18:38:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral Associate - Bioinformatics  at Duke University Medical Center]]></title>
  <description><![CDATA[
<p>The Department of Biostatistics and Bioinformatics at Duke University Medical Center is seeking a Postdoctoral Associate for a one year appointment to work on several high-dimensional research projects. The specific goals of the project are to identify genes or molecular markers that are predictive of clinical outcomes in renal and prostate cancer.</p>

<p>Candidates must have: a PhD degree in statistics, biostatistics or bioinformatics, extensive experience in analyzing high-dimensional data (microarray, SNP, CNVs) and of validation approaches. In addition, experience in penalized regression methods, data base manipulation; and strong programming skills in order to conduct Monte Carlo studies and applications (R). Candidate must have excellent communication skills (verbal, written and presentation), a strong proficiency in Linux system.</p>

<p>This position is available immediately and will be filled as soon as possible. Appointment could be extended beyond the first year based on additional funding.</p>

<p>For more information about the Department of Biostatistics and Bioinformatics, please visit our website: http://www.biostat.duke.edu.</p>

<p>For more info: http://biostat.duke.edu/sites/biostat.duke.edu/files/Halabi%20-%20Postdoc%20Job%20Posting%202013%20updated.pdf</p>

<p>Duke University is an Equal Opportunity/Affirmative Action Employer.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34814/bioinformatics-web-application-development-with-perl</guid>
	<pubDate>Tue, 26 Dec 2017 18:14:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34814/bioinformatics-web-application-development-with-perl</link>
	<title><![CDATA[Bioinformatics Web Application Development with Perl]]></title>
	<description><![CDATA[<div><p>Perl's second wave of adoption came from the growth of the world wide web. Dynamic web pages&mdash;the precursor to modern web applications&mdash;were easy to create with Perl and CGI. Thanks to Perl's ubiquity as a language for system administrators and its power to manipulate text, it was the default choice for web programming. Its presence everywhere made it popular and, in some ways, the duct tape of the Internet.</p><h4>Web Application Development</h4><p>The old days of CGI programs and the simple development style that represented seem clunky. Web pages have become web applications. Development has moved from generating static HTML to both client and server side programming, with rich client interfaces and powerful backends.</p><p>Perl is still well suited for developing modern web apps. The language grows more powerful and easier to use every year, the available libraries are wonderful and keep getting better, and the inventions and discoveries available in modern Perl are unsurpassed.</p><p>In particular, a modern Perl developer can do amazing things with modern Perl tools. If you still think of Perl web development as a&nbsp;<em>cgi-bin</em>&nbsp;directory full of messy scripts that spew warnings to STDERR, you're a decade out of date. Better yet, you can replace that mess piecemeal, thanks to the new tools and techniques of modern Perl. See, for example, the ever-growing list of technologies&nbsp;<a href="http://www.builtinperl.com/">Built in Perl</a>.</p><h4>Modern Perl Web Frameworks</h4><p>While the old wave of web development may have made the CGI.pm module central, modern Perl web programming follows a stricter separation of business logic, URL and request routing, and output. The days of slinging a string here, an array there, a Perl hash yonder, declaring every variable at the top of the program, and maybe making a subroutine are gone. The Perl world has seen the value of abstraction and ways to mechanize away boilerplate. Perl has dozens of frameworks and toolkits designed to make web development and deployment simpler.</p><p>Any of a dozen of these frameworks will help you do great things, but three in particular stand out. You can build web sites and web applications of tremendous value with all three. These are neither the only good possibilities (think of POE or Jifty or Continuity or...) nor the only mechanisms for web programming with Perl (see Mechanize or LWP or Mojo::UserAgent for more). Yet if you want three good options to choose between, start here.</p><h4>Catalyst</h4><p>The&nbsp;<a href="http://catalystframework.org/">Catalyst</a>&nbsp;framework is a flexible and powerful system for building small to large web apps. It uses the&nbsp;<a href="http://moose.perl.org/">Moose</a>&nbsp;object system to provide great APIs for extension and further development. It's the most mature of the modern top Perl web frameworks, yet it retains its flexibility and vibrancy. In particular, its plugin and extension ecosystem allows it to evolve to provide new and essential features.</p><p>Catalyst has embraced the Plack/PSGI standard for Perl web deployment and recent versions are exploring high-scalability, event-based request handling models.</p><h4>Dancer</h4><p>The&nbsp;<a href="http://perldancer.org/">Dancer</a>&nbsp;framework is deliberately minimal in syntax and scope, but it also has a vibrant plugin ecosystem. Dancer particularly excels for smaller sites and applications, though good programmers can build larger things with it.</p><p>The first version of Dancer was easy to use. Dancer 2 continues that ease while improving the internals and robustness of applications.</p><h4>Mojolicious</h4><p>The&nbsp;<a href="http://mojolicio.us/">Mojolicious</a>&nbsp;(Mojo) framework has a real-time design based on high performance event handling. Its focus is solving new and interesting problems in simple and effective ways, and the project has produced a lot of new code that does old things in better ways.</p><p>In particular, Mojolicious goes to great lengths to support new web standards, such as CSS 3, web sockets, and HTTP 2.</p><p>Where Catalyst embraces the CPAN fully, Mojolicious by design provides most of what an average app might need in a single download. It's still fully compatible with the CPAN, but the intention is to provide good working defaults in a package that's easy to start with. Mojo's fans are quick to praise it as fun to develop.</p><p>A modern Perl web developer should be familiar with at least one of these frameworks.</p><h4>Modern Perl Storage Mechanisms</h4><p>Perl's venerable&nbsp;<a href="http://search.cpan.org/perldoc?DBI">DBI</a>&nbsp;module has been the focal point of database access since its invention. Its design allows it to provide the same interface to huge relational databases and flat files alike through its DBD extension mechanism. Yet the DBI by itself isn't the be-all, end-all of data storage and access in Perl.</p><h4>DBIx::Class</h4><p><a href="http://search.cpan.org/perldoc?DBIx::Class">DBIx::Class</a>&nbsp;sits on top of DBI to provide an API to your database based on the concept of queries and results. This is often sufficient to remove all but the most complicated of SQL from your code, leaving you to manipulate your business models instead of the small details of how a relational database works. The power and maintainability you receive is well the small cost of the learning curve.</p><p>Even better, DBIC can manage (and even generate) your database schema for you.</p><p>Recent versions of DBIC have demonstrated that a well-written ORM can perform much better than even clever hand-written code. Because it builds on the Perl DBI, it scales everywhere from SQLite to PostgreSQL, MySQL, Oracle, and more.</p><h3>Rose::DB</h3><p>The lesser-known but no less powerful&nbsp;<a href="http://search.cpan.org/perldoc?Rose::DB::Object">Rose::DB::Object</a>&nbsp;builds on&nbsp;<a href="http://search.cpan.org/perldoc?Rose::DB">Rose::DB</a>&nbsp;to provide an object-relational mapper for Perl. While its high level features most directly compare to those of DBIx::Class, it's often measurably faster.</p><h4>NoSQL on the CPAN</h4><p>Of course the&nbsp;<a href="http://search.cpan.org/">CPAN</a>&nbsp;has modules for almost any NoSQL database or job queue or persistence mechanism you could name, and several you have never heard of. Everything you need is a quick CPAN or cpanm away!</p><h4>Modern Perl Deployment Strategies</h4><p>In the early days of the web, deploying a Perl web application meant putting one or more&nbsp;<em>.cgi</em>&nbsp;or&nbsp;<em>.pl</em>&nbsp;files in a special directory and hoping that your system administrator had everything configured correctly. The execution model was often slow and cumbersome, and accessing shared resources such as databases was often tricky.</p><p>Modern Perl has better choices. While deployment strategies are the source of many arguments, the return on your investment from learning the modern way is impressive.</p><h4>Plack/PSGI</h4><p>The PSGI specification (as exemplified by&nbsp;<a href="http://plackperl.org/">Plack</a>) describes a strategy for building Perl web apps independent of server and with the possibility to share custom processing behaviors.</p><p>In other words, it's a standard for writing Perl apps to take advantage of the huge ecosystem of Perl development available on the CPAN without tying yourself to a server like Apache, Apache 2, nginx, or anything else.</p><p>Any good modern Perl web framework (including those listed here) supports PSGI. Several deployment mechanisms exist to meet various business needs which also support PSGI. In particular, you can deploy the same application with a local testing server on your own machine as you can to your production server or servers without changing your application at all.</p><h4>mod_perl</h4><p>The older but still viable mod_perl Apache httpd module embeds Perl into the web server. This was the first widespread persistence mechanism for Perl web applications themselves and it's still popular to this day, though PSGI compliance is often the choice for new development. (PSGI handlers to use mod_perl as the backend are available.)</p><p>Modern Perl developers should familiarize themselves with PSGI and the wealth of available Plack middleware.</p><h4>Perl Web Development</h4><p>Of course no discussion of Perl web development would be complete without mentioning the strength of the CPAN. Almost any project will benefit from the wealth of freely available libraries built to solve real problems. These distributions run the gamut from full-blown web frameworks and content management systems to APIs for web services, development tools, testing systems, and interfaces to document formats and external resources.</p><p>For example, if you need to write a web service which accepts JSON data and produces Excel spreadsheets, you can glue together a few CPAN distributions and get the job done early. If you need to consume XML from a remote service and emit a PDF, you're in luck.</p><p>Perl's prowess as a general purpose programming language as well as its flexibility and power in managing text and gluing systems together make it a wonderful fit for web development. The community's adoption of modern Perl standards such as PSGI and Plack only enhance your power.</p><p>Web application development in Perl is still viable, and modern Perl tools and techniques and libraries make it more powerful and pleasant than ever.</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39606/amity-university-bioinformatics-summer-program-kolkata</guid>
	<pubDate>Tue, 11 Jun 2019 21:27:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39606/amity-university-bioinformatics-summer-program-kolkata</link>
	<title><![CDATA[Amity University Bioinformatics Summer Program - Kolkata]]></title>
	<description><![CDATA[<p>Registrations are now open for the 2019 Summer Bioinformatics Training program at Amity University, Kolkata. The program will focus on introductory topics for life science students. We will review important history, topics and challenges bioinformatics can help address in the context of basic research, discovery and industry.</p><p>Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11181/perl-one-liner-for-bioinformatician</guid>
	<pubDate>Fri, 30 May 2014 05:49:07 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11181/perl-one-liner-for-bioinformatician</link>
	<title><![CDATA[Perl one-liner for bioinformatician !!!]]></title>
	<description><![CDATA[<p>With the emergence of NGS technologies, and sequencing data most of the bioinformaticians mung and wrangle around massive amounts of genomics text. There are several "standardized" file formats (FASTQ, SAM, VCF, etc.) and some tools for manipulating them (fastx toolkit, samtools, vcftools, etc.), there are still times where knowing a little bit of Perl onliner is extremely helpful.</p><p>Perl one-liners are small and awesome Perl programs that fit in a single line of code and they do one thing really well. These things include changing line spacing, numbering lines, doing calculations, converting and substituting text, deleting and printing certain lines, parsing logs, editing files in-place, doing statistics, carrying out system administration tasks, updating a bunch of files at once, and many more. Perl one-liners will make you the shell warrior. Anything that took you minutes to solve, will now take you seconds!<br /><br />perl -pe '$\="\n"'&nbsp; &nbsp;<br />#double space a file<br /><br />perl -pe '$_ .= "\n" unless /^$/' <br />#double space a file except blank lines<br /><br />perl -pe '$_.="\n"x7' <br />#7 space in a line.<br /><br />perl -ne 'print unless /^$/' <br />#remove all blank lines<br /><br />perl -lne 'print if length($_) &lt; 20' <br />#print all lines with length less than 20.<br /><br />perl -00 -pe '' <br />#If there are multiple spaces, delete all leaving one(make the file a single spaced file).<br /><br />perl -00 -pe '$_.="\n"x4' <br />#Expand single blank lines into 4 consecutive blank lines<br /><br />perl -pe '$_ = "$. $_"'<br />#Number all lines in a file<br /><br />perl -pe '$_ = ++$a." $_" if /./' <br />#Number only non-empty lines in a file<br /><br />perl -ne 'print ++$a." $_" if /./' <br />#Number and print only non-empty lines in a file<br /><br />perl -pe '$_ = ++$a." $_" if /regex/' <br />#Number only lines that match a pattern<br /><br />perl -ne 'print ++$a." $_" if /regex/' <br />#Number and print only lines that match a pattern<br /><br />perl -ne 'printf "%-5d %s", $., $_ if /regex/' <br />#Left align lines with 5 white spaces if matches a pattern (perl -ne 'printf "%-5d %s", $., $_' : for all the lines)<br /><br />perl -le 'print scalar(grep{/./}&lt;&gt;)' <br />#prints the total number of non-empty lines in a file<br /><br />perl -lne '$a++ if /regex/; END {print $a+0}' <br />#print the total number of lines that matches the pattern<br /><br />perl -alne 'print scalar @F' <br />#print the total number fields(words) in each line.<br /><br />perl -alne '$t += @F; END { print $t}' <br />#Find total number of words in the file<br /><br />perl -alne 'map { /regex/ &amp;&amp; $t++ } @F; END { print $t }' <br />#find total number of fields that match the pattern<br /><br />perl -lne '/regex/ &amp;&amp; $t++; END { print $t }' <br />#Find total number of lines that match a pattern<br /><br />perl -le '$n = 20; $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $m' <br />#will calculate the GCD of two numbers.<br /><br />perl -le '$a = $n = 20; $b = $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $a*$b/$m' <br />#will calculate lcd of 20 and 35.<br /><br />perl -le '$n=10; $min=5; $max=15; $, = " "; print map { int(rand($max-$min))+$min } 1..$n' <br />#Generates 10 random numbers between 5 and 15.<br /><br />perl -le 'print map { ("a".."z",&rdquo;0&rdquo;..&rdquo;9&rdquo;)[rand 36] } 1..8'<br />#Generates a 8 character password from a to z and number 0 &ndash; 9.<br /><br />perl -le 'print map { ("a",&rdquo;t&rdquo;,&rdquo;g&rdquo;,&rdquo;c&rdquo;)[rand 4] } 1..20'<br />#Generates a 20 nucleotide long random residue.<br /><br />perl -le 'print "a"x50'<br />#generate a string of &lsquo;x&rsquo; 50 character long<br /><br />perl -le 'print join ", ", map { ord } split //, "hello world"'<br />#Will print the ascii value of the string hello world.<br /><br />perl -le '@ascii = (99, 111, 100, 105, 110, 103); print pack("C*", @ascii)'<br />#converts ascii values into character strings.<br /><br />perl -le '@odd = grep {$_ % 2 == 1} 1..100; print "@odd"'<br />#Generates an array of odd numbers.<br /><br />perl -le '@even = grep {$_ % 2 == 0} 1..100; print "@even"'<br />#Generate an array of even numbers<br /><br />perl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file <br />#Convert the entire file into 13 characters offset(ROT13)<br /><br />perl -nle 'print uc' <br />#Convert all text to uppercase:<br /><br />perl -nle 'print lc' <br />#Convert text to lowercase:<br /><br />perl -nle 'print ucfirst lc' <br />#Convert only first letter of first word to uppercas<br /><br />perl -ple 'y/A-Za-z/a-zA-Z/' <br />#Convert upper case to lower case and vice versa<br /><br />perl -ple 's/(\w+)/\u$1/g' <br />#Camel Casing<br /><br />perl -pe 's|\n|\r\n|' <br />#Convert unix new lines into DOS new lines:<br /><br />perl -pe 's|\r\n|\n|' <br />#Convert DOS newlines into unix new line<br /><br />perl -pe 's|\n|\r|' <br />#Convert unix newlines into MAC newlines:<br /><br />perl -pe '/regexp/ &amp;&amp; s/foo/bar/' <br />#Substitute a foo with a bar in a line with a regexp.</p><p>Reference/Sources:</p><p>http://genomics-array.blogspot.in/2010/11/some-unixperl-oneliners-for.html</p><p><a href="http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html">http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html</a></p><p><a href="http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/">http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/</a></p><p><a href="http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html">http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html</a></p><p><a href="http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/">http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</guid>
	<pubDate>Tue, 07 Aug 2018 10:01:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</link>
	<title><![CDATA[VCFtools: perform common tasks with VCF files such as file validation, file merging, intersecting, complements]]></title>
	<description><![CDATA[<p>VCFtools contains a Perl API (<a href="http://vcftools.sourceforge.net/perl_module.html#Vcf.pm">Vcf.pm</a>) and a number of Perl scripts that can be used to perform common tasks with VCF files such as file validation, file merging, intersecting, complements, etc. The Perl tools support all versions of the VCF specification (3.2, 3.3, 4.0, 4.1 and 4.2), nevertheless, the users are encouraged to use the latest versions VCFv4.1 or VCFv4.2. The VCFtools in general have been used mainly with diploid data, but the Perl tools aim to support polyploid data as well. Run any of the Perl scripts with the&nbsp;<strong>--help</strong>&nbsp;switch to obtain more help.</p>
<p>Many of the&nbsp;<strong>Perl scripts require that the VCF files are compressed by&nbsp;<span>bgzip</span>&nbsp;and indexed by&nbsp;<span>tabix</span></strong>&nbsp;(both tools are part of the tabix package, available for&nbsp;<a href="https://sourceforge.net/projects/samtools/files/tabix/">download here</a>). The VCF files can be compressed and indexed using the following commands</p>
<p>bgzip my_file.vcf<br>tabix -p vcf my_file.vcf.gz</p>
<p>&nbsp;</p>
<p>http://vcftools.sourceforge.net/perl_module.html</p><p>Address of the bookmark: <a href="http://vcftools.sourceforge.net/perl_module.html" rel="nofollow">http://vcftools.sourceforge.net/perl_module.html</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11457/commercial-and-public-next-gen-seq-ngs-software</guid>
	<pubDate>Tue, 03 Jun 2014 20:45:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11457/commercial-and-public-next-gen-seq-ngs-software</link>
	<title><![CDATA[Commercial and public next-gen-seq (NGS) software]]></title>
	<description><![CDATA[<p><strong>Integrated solutions</strong><br /> <a href="http://www.clcbio.com/index.php?id=1240" target="_blank">CLCbio Genomics Workbench</a> - <em>de novo</em> and reference assembly of Sanger, Roche FLX, Illumina, Helicos, and SOLiD data. Commercial next-gen-seq software that extends the CLCbio Main Workbench software. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Windows, Mac OS X and Linux.<br /><a href="http://g2.trac.bx.psu.edu/" target="_blank">Galaxy</a> - Galaxy = interactive and reproducible genomics. A job webportal.<br /> <a href="http://www.genomatix.de/products/index.html" target="_blank">Genomatix</a> - Integrated Solutions for Next Generation Sequencing data analysis.<br /> <a href="http://www.jmp.com/software/genomics/" target="_blank">JMP Genomics</a> - Next gen visualization and statistics tool from SAS. They are <a href="http://www.marketwatch.com/news/story/JMPR-Genomics-NCGR-Partnership-Foster/story.aspx?guid=%7B7AC9DE36-B6AA-4EDE-9CD5-633B29FE6154%7D" target="_blank">working with NCGR</a> to refine this tool and produce others.<br /> <a href="http://softgenetics.com/NextGENe.html" target="_blank">NextGENe</a> - <em>de novo</em> and reference assembly of Illumina, SOLiD and Roche FLX data. Uses a novel Condensation Assembly Tool approach where reads are joined via "anchors" into mini-contigs before assembly. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Win or MacOS.<br /><a href="http://www.partek.com" target="_blank" title="Partek Incorporated">Partek</a>&nbsp;<span>- Commercial software for NGS, microarray, and qPCR data analysis. Streamlined analysis workflows for: ChIP-Seq, RNA-Seq, DNA-Seq, DNA Methylation, Gene Expression, Exon, miRNA Expression, Copy Number, Allele-Specific Copy Number, LOH, Association, Trio Analysis, and Tiling. Supports all commercial sequencing and microarray technologies.&nbsp;</span><br /> <a href="http://www.dnastar.com/products/SMGA.php" target="_blank">SeqMan Genome Analyser</a> - Software for Next Generation sequence assembly of Illumina, Roche FLX and Sanger data integrating with Lasergene Sequence Analysis software for additional analysis and visualization capabilities. Can use a hybrid templated/de novo approach. Commercial. Win or Mac OS X.<br /><a href="http://1001genomes.org/downloads/shore.html" target="_blank">SHORE</a> - SHORE, for Short Read, is a mapping and analysis pipeline for short DNA sequences produced on a Illumina Genome Analyzer. A suite created by the 1001 Genomes project. Source for POSIX.<br /> <a href="http://www.realtimegenomics.com/" target="_blank">SlimSearch</a> - Fledgling commercial product.<br />Synamatix has SXOligoSearch (<a href="http://synasite.mgrc.com.my:8080/sxog/NewSXOligoSearch.php" target="_blank">http://synasite.mgrc.com.my:8080/sxo...ligoSearch.php</a>)<br />The SWIFT suit is a software collection for fast index-based sequence comparison. It contains the following programs: SWIFT &mdash; fast local alignment search, guaranteeing to find epsilon-matches between two sequences; SWIFT BALSAM &mdash; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. <a href="http://bibiserv.techfak.uni-bielefeld.de/swift/" target="_blank">http://bibiserv.techfak.uni-bielefeld.de/swift/</a><br /><a href="http://http//bioinf.comav.upv.es/svn/biolib/biolib/src/" target="_blank">biolib</a>.is library and a set of script targeted to NGS. There are modules to: clean sequences (sanger, 454, ilumina), parse caf, ace and bowtie map files, clean and filter contigs, look for snps and indels., filter snps, do statistics for: reads, contigs and snps.</p><p><br /> <strong>Align/Assemble to a reference</strong><br /> <a href="https://secure.genome.ucla.edu/index.php/BFAST" target="_blank">BFAST</a> - Blat-like Fast Accurate Search Tool. Written by Nils Homer, Stanley F. Nelson and Barry Merriman at UCLA.<br /><a href="http://bowtie-bio.sourceforge.net/" target="_blank">Bowtie</a> - Ultrafast, memory-efficient short read aligner. It aligns short DNA sequences (reads) to the human genome at a rate of 25 million reads per hour on a typical workstation with 2 gigabytes of memory. Uses a Burrows-Wheeler-Transformed (BWT) index. <a href="http://seqanswers.com/forums/showthread.php?t=706" target="_blank">Link to discussion thread here</a>. Written by Ben Langmead and Cole Trapnell. Linux, Windows, and Mac OS X.<br /> <a href="http://maq.sourceforge.net/" target="_blank">BWA</a> - Heng Lee's BWT Alignment program - a progression from Maq. BWA is a fast light-weighted tool that aligns short sequences to a sequence database, such as the human reference genome. By default, BWA finds an alignment within edit distance 2 to the query sequence. C++ source.<br /> <a href="http://bioinfo.cgrb.oregonstate.edu/docs/solexa/" target="_blank">ELAND</a> - Efficient Large-Scale Alignment of Nucleotide Databases. Whole genome alignments to a reference genome. Written by Illumina author Anthony J. Cox for the Solexa 1G machine.<br /> <a href="http://www.ebi.ac.uk/%7Eguy/exonerate/" target="_blank">Exonerate</a> - Various forms of pairwise alignment (including Smith-Waterman-Gotoh) of DNA/protein against a reference. Authors are Guy St C Slater and Ewan Birney from EMBL. C for POSIX.<br /> <a href="http://1001genomes.org/downloads/genomemapper.html" target="_blank">GenomeMapper</a> - GenomeMapper is a short read mapping tool designed for accurate read alignments. It quickly aligns millions of reads either with ungapped or gapped alignments. A tool created by the 1001 Genomes project. Source for POSIX.<br /> <a href="http://www.gene.com/share/gmap/" target="_blank">GMAP</a> - GMAP (Genomic Mapping and Alignment Program) for mRNA and EST Sequences. Developed by Thomas Wu and Colin Watanabe at Genentec. C/Perl for Unix.<br /> <a href="http://dna.cs.byu.edu/gnumap/" target="_blank">gnumap</a> - The Genomic Next-generation Universal MAPper (gnumap) is a program designed to accurately map sequence data obtained from next-generation sequencing machines (specifically that of Solexa/Illumina) back to a genome of any size. It seeks to align reads from nonunique repeats using statistics. From authors at Brigham Young University. C source/Unix.<br /> <a href="http://sourceforge.net/projects/maq/" target="_blank">MAQ</a> - Mapping and Assembly with Qualities (renamed from MAPASS2). Particularly designed for Illumina with preliminary functions to handle ABI SOLiD data. Written by Heng Li from the Sanger Centre. Features extensive supporting tools for DIP/SNP detection, etc. C++ source<br /> <a href="http://bioinformatics.bc.edu/marthlab/Mosaik" target="_blank">MOSAIK</a> - MOSAIK produces gapped alignments using the Smith-Waterman algorithm. Features a number of support tools. Support for Roche FLX, Illumina, SOLiD, and Helicos. Written by Michael Str&ouml;mberg at Boston College. Win/Linux/MacOSX<br /> <a href="http://mrfast.sourceforge.net/" target="_blank">MrFAST and MrsFAST</a> - mrFAST &amp; mrsFAST are designed to map short reads generated with the Illumina platform to reference genome assemblies; in a fast and memory-efficient manner. Robust to INDELs and MrsFAST has a bisulphite mode. Authors are from the University of Washington. C as source.<br /> <a href="http://mummer.sourceforge.net/" target="_blank">MUMmer</a> - MUMmer is a modular system for the rapid whole genome alignment of finished or draft sequence. Released as a package providing an efficient suffix tree library, seed-and-extend alignment, SNP detection, repeat detection, and visualization tools. Version 3.0 was developed by Stefan Kurtz, Adam Phillippy, Arthur L Delcher, Michael Smoot, Martin Shumway, Corina Antonescu and Steven L Salzberg - most of whom are at The Institute for Genomic Research in Maryland, USA. POSIX OS required.<br /> <a href="http://www.novocraft.com/index.html" target="_blank">Novocraft</a> - Tools for reference alignment of paired-end and single-end Illumina reads. Uses a Needleman-Wunsch algorithm. Can support Bis-Seq. Commercial. Available free for evaluation, educational use and for use on open not-for-profit projects. Requires Linux or Mac OS X.<br /> <a href="http://pass.cribi.unipd.it/cgi-bin/pass.pl" target="_blank">PASS</a> - It supports Illumina, SOLiD and Roche-FLX data formats and allows the user to modulate very finely the sensitivity of the alignments. Spaced seed intial filter, then NW dynamic algorithm to a SW(like) local alignment. Authors are from CRIBI in Italy. Win/Linux.<br /> <a href="http://rulai.cshl.edu/rmap/" target="_blank">RMAP</a> - Assembles 20 - 64 bp Illumina reads to a FASTA reference genome. By Andrew D. Smith and Zhenyu Xuan at CSHL. (published in BMC Bioinformatics). POSIX OS required.<br /> <a href="http://biogibbs.stanford.edu/%7Ejiangh/SeqMap/" target="_blank">SeqMap</a> - Supports up to 5 or more bp mismatches/INDELs. Highly tunable. Written by Hui Jiang from the Wong lab at Stanford. Builds available for most OS's.<br /> <a href="http://compbio.cs.toronto.edu/shrimp/" target="_blank">SHRiMP</a> - Assembles to a reference sequence. Developed with Applied Biosystem's colourspace genomic representation in mind. Authors are Michael Brudno and Stephen Rumble at the University of Toronto. POSIX.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/slider" target="_blank"><span style="text-decoration: underline;">Slider</span></a>- An application for the Illumina Sequence Analyzer output that uses the probability files instead of the sequence files as an input for alignment to a reference sequence or a set of reference sequences. Authors are from BCGSC. Paper is <a href="http://seqanswers.com/forums/showthread.php?t=740" target="_blank">here</a>.<br /> <a href="http://soap.genomics.org.cn/" target="_blank">SOAP</a> - SOAP (Short Oligonucleotide Alignment Program). A program for efficient gapped and ungapped alignment of short oligonucleotides onto reference sequences. The updated version uses a BWT. Can call SNPs and INDELs. Author is Ruiqiang Li at the Beijing Genomics Institute. C++, POSIX.<br /> <a href="http://www.sanger.ac.uk/Software/analysis/SSAHA/" target="_blank">SSAHA</a> - SSAHA (Sequence Search and Alignment by Hashing Algorithm) is a tool for rapidly finding near exact matches in DNA or protein databases using a hash table. Developed at the Sanger Centre by Zemin Ning, Anthony Cox and James Mullikin. C++ for Linux/Alpha.<br /> <a href="http://socs.biology.gatech.edu/" target="_blank">SOCS</a> - Aligns SOLiD data. SOCS is built on an iterative variation of the Rabin-Karp string search algorithm, which uses hashing to reduce the set of possible matches, drastically increasing search speed. Authors are Ondov B, Varadarajan A, Passalacqua KD and Bergman NH.<br /> <a href="http://bibiserv.techfak.uni-bielefeld.de/swift/welcome.html" target="_blank">SWIFT</a> - The SWIFT suit is a software collection for fast index-based sequence comparison. It contains: SWIFT &mdash; fast local alignment search, guaranteeing to find epsilon-matches between two sequences. SWIFT BALSAM &mdash; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. Authors are Kim Rasmussen (SWIFT) and Wolfgang Gerlach (SWIFT BALSAM)<br /> <a href="http://synasite.mgrc.com.my:8080/sxog/NewSXOligoSearch.php" target="_blank">SXOligoSearch</a> - SXOligoSearch is a commercial platform offered by the Malaysian based <a href="http://www.synamatix.com/" target="_blank">Synamatix</a>. Will align Illumina reads against a range of Refseq RNA or NCBI genome builds for a number of organisms. Web Portal. OS independent.<br /> <a href="http://www.vmatch.de/" target="_blank">Vmatch</a> - A versatile software tool for efficiently solving large scale sequence matching tasks. Vmatch subsumes the software tool REPuter, but is much more general, with a very flexible user interface, and improved space and time requirements. Essentially a large string matching toolbox. POSIX.<br /> <a href="http://www.bioinformaticssolutions.com/products/zoom/index.php" target="_blank">Zoom</a> - ZOOM (Zillions Of Oligos Mapped) is designed to map millions of short reads, emerged by next-generation sequencing technology, back to the reference genomes, and carry out post-analysis. ZOOM is developed to be highly accurate, flexible, and user-friendly with speed being a critical priority. Commercial. Supports Illumina and SOLiD data.<br />NCGR uses GMAP (<a href="http://www.gene.com/share/gmap/" target="_blank">http://www.gene.com/share/gmap/</a>) to alignment Solexa reads. GMAP is free, though.<br />Exonerate (<a href="http://www.ebi.ac.uk/%7Eguy/exonerate/" target="_blank">http://www.ebi.ac.uk/~guy/exonerate/</a>)<br /> MUMmer (<a href="http://mummer.sourceforge.net/" target="_blank">http://mummer.sourceforge.net/</a>)<br /> The mapping short reads called gnumap (<a href="http://dna.cs.byu.edu/gnumap/" target="_blank">http://dna.cs.byu.edu/gnumap/</a>) made to increase the accuracy with duplicate matches. Open source, creates viewable output (with Affy's Integrated Genome Browser), and produces results very similar to novocraft's.<br /><a href="http://socs.biology.gatech.edu/" target="_blank">SOCS</a> (short oligonucleotides in color space)<br />BFAST <a href="https://secure.genome.ucla.edu/index.php/BFAST" target="_blank">https://secure.genome.ucla.edu/index.php/BFAST</a></p><p><br /> <strong><em>De novo</em> Align/Assemble</strong><br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/abyss" target="_blank">ABySS</a> - Assembly By Short Sequences. ABySS is a de novo sequence assembler that is designed for very short reads. The single-processor version is useful for assembling genomes up to 40-50 Mbases in size. The parallel version is implemented using MPI and is capable of assembling larger genomes. By Simpson JT and others at the Canada's Michael Smith Genome Sciences Centre. C++ as source. <br /> <a href="http://www.broad.mit.edu/science/programs/genome-biology/computational-rd/computational-research-and-development" target="_blank">ALLPATHS</a> - ALLPATHS: De novo assembly of whole-genome shotgun microreads. ALLPATHS is a whole genome shotgun assembler that can generate high quality assemblies from short reads. Assemblies are presented in a graph form that retains ambiguities, such as those arising from polymorphism, thereby providing information that has been absent from previous genome assemblies. Broad Institute.<br /> <a href="http://www.genomic.ch/edena.php" target="_blank">Edena</a> - Edena (Exact DE Novo Assembler) is an assembler dedicated to process the millions of very short reads produced by the Illumina Genome Analyzer. Edena is based on the traditional overlap layout paradigm. By D. Hernandez, P. Fran&ccedil;ois, L. Farinelli, M. Osteras, and J. Schrenzel. Linux/Win.<br /> <a href="http://euler-assembler.ucsd.edu/portal/" target="_blank">EULER-SR</a> - Short read <em>de novo</em> assembly. By Mark J. Chaisson and Pavel A. Pevzner from UCSD (published in Genome Research). Uses a de Bruijn graph approach.<br /> <a href="http://chevreux.org/projects_mira.html" target="_blank">MIRA2</a> - MIRA (Mimicking Intelligent Read Assembly) is able to perform true hybrid de-novo assemblies using reads gathered through 454 sequencing technology (GS20 or GS FLX). Compatible with 454, Solexa and Sanger data. Linux OS required.<br /> <a href="http://www.seqan.de/projects/consensus.html" target="_blank">SEQAN</a> - A Consistency-based Consensus Algorithm for De Novo and Reference-guided Sequence Assembly of Short Reads. By Tobias Rausch and others. C++, Linux/Win.<br /> <a href="http://sharcgs.molgen.mpg.de/" target="_blank">SHARCGS</a> - De novo assembly of short reads. Authors are Dohm JC, Lottaz C, Borodina T and Himmelbauer H. from the Max-Planck-Institute for Molecular Genetics.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/ssake" target="_blank">SSAKE</a> - The Short Sequence Assembly by K-mer search and 3' read Extension (SSAKE) is a genomics application for aggressively assembling millions of short nucleotide sequences by progressively searching for perfect 3'-most k-mers using a DNA prefix tree. Authors are Ren&eacute; Warren, Granger Sutton, Steven Jones and Robert Holt from the Canada's Michael Smith Genome Sciences Centre. Perl/Linux.<br /> <a href="http://soap.genomics.org.cn/" target="_blank">SOAPdenovo</a> - Part of the SOAP suite. See above. <br /> <a href="https://sourceforge.net/projects/vcake" target="_blank">VCAKE</a> - De novo assembly of short reads with robust error correction. An improvement on early versions of SSAKE.<br /> <a href="http://www.ebi.ac.uk/%7Ezerbino/velvet/" target="_blank">Velvet</a> - Velvet is a de novo genomic assembler specially designed for short read sequencing technologies, such as Solexa or 454. Need about 20-25X coverage and paired reads. Developed by Daniel Zerbino and Ewan Birney at the European Bioinformatics Institute (EMBL-EBI).<br />SOAP (<a href="http://soap.genomics.org.cn" target="_blank">http://soap.genomics.org.cn</a>) by Ruiqiang Li, as has been pointed by ECO.<br />Euler-SR (Euler-Short Reads Assembly, <a href="http://euler-assembler.ucsd.edu/portal/" target="_blank">http://euler-assembler.ucsd.edu/portal/</a>) by Mark J. Chaisson and Pavel A. Pevzner from UCSD. (published in Genome Research)<br />RMAP (A program for mapping Solexa reads, <a href="http://rulai.cshl.edu/rmap/" target="_blank">http://rulai.cshl.edu/rmap/</a>) by Andrew D. Smith and Zhenyu Xuan at CSHL. (published in BMC Bioinformatics)<br />Short read aligner called Bowtie (<a href="http://bowtie-bio.sourceforge.net/" target="_blank">http://bowtie-bio.sourceforge.net/</a>) designed for fast mapping of Illumina reads<br /> <br /> <strong>SNP/Indel Discovery</strong><br /> <a href="http://www.sanger.ac.uk/Software/analysis/ssahaSNP/" target="_blank">ssahaSNP</a> - ssahaSNP is a polymorphism detection tool. It detects homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence numbers. More tuned for ABI Sanger reads. Developers are Adam Spargo and Zemin Ning from the Sanger Centre. Compaq Alpha, Linux-64, Linux-32, Solaris and Mac<br /> <a href="http://bioinformatics.bc.edu/marthlab/PbShort" target="_blank">PolyBayesShort</a> - A re-incarnation of the PolyBayes SNP discovery tool developed by Gabor Marth at Washington University. This version is specifically optimized for the analysis of large numbers (millions) of high-throughput next-generation sequencer reads, aligned to whole chromosomes of model organism or mammalian genomes. Developers at Boston College. Linux-64 and Linux-32.<br /> <a href="http://bioinformatics.bc.edu/marthlab/PyroBayes" target="_blank">PyroBayes</a> - PyroBayes is a novel base caller for pyrosequences from the 454 Life Sciences sequencing machines. It was designed to assign more accurate base quality estimates to the 454 pyrosequences. Developers at Boston College.<br />Maq is also able to find SNPs with its own alignment. It has a graphical viewer, but again for its own alignment format.<br />SSAHA has been optimized for short-reads, too. But yes, SSAHASNP appears in your "SNP/INDEL discovery" category.<br /> <br /> <strong>Genome Annotation/Genome Browser/Alignment Viewer/Assembly Database</strong><br /> <a href="http://bioinformatics.bc.edu/marthlab/EagleView" target="_blank">EagleView</a> - An information-rich genome assembler viewer. EagleView can display a dozen different types of information including base quality and flowgram signal. Developers at Boston College.<br /> <a href="http://www.sanger.ac.uk/Software/analysis/lookseq/" target="_blank">LookSeq</a> - LookSeq is a web-based application for alignment visualization, browsing and analysis of genome sequence data. LookSeq supports multiple sequencing technologies, alignment sources, and viewing modes; low or high-depth read pileups; and easy visualization of putative single nucleotide and structural variation. From the Sanger Centre.<br /> <a href="http://evolution.sysu.edu.cn/mapview/" target="_blank">MapView</a> - MapView: visualization of short reads alignment on desktop computer. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China. Linux.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/sam" target="_blank">SAM</a> - Sequence Assembly Manager. Whole Genome Assembly (WGA) Management and Visualization Tool. It provides a generic platform for manipulating, analyzing and viewing WGA data, regardless of input type. Developers are Rene Warren, Yaron Butterfield, Asim Siddiqui and Steven Jones at Canada's Michael Smith Genome Sciences Centre. MySQL backend and Perl-CGI web-based frontend/Linux. <br /> <a href="http://staden.sourceforge.net/" target="_blank">STADEN</a> - Includes GAP4. GAP5 once completed will handle next-gen sequencing data. A partially implemented test version is available <a href="https://sourceforge.net/project/show...kage_id=256957" target="_blank">here</a><br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/xmatchview" target="_blank">XMatchView</a> - A visual tool for analyzing cross_match alignments. Developed by Rene Warren and Steven Jones at Canada's Michael Smith Genome Sciences Centre. Python/Win or Linux.<br /> <br /> <strong>Counting e.g. CHiP-Seq, Bis-Seq, CNV-Seq</strong><br /> <a href="http://epigenomics.mcdb.ucla.edu/BS-Seq/download.html" target="_blank">BS-Seq</a> - The source code and data for the "Shotgun Bisulphite Sequencing of the Arabidopsis Genome Reveals DNA Methylation Patterning" Nature paper by <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?holding=&amp;db=pubmed&amp;cmd=search&amp;term=Shotgun%20Bisulphite%20Sequencing" target="_blank">Cokus et al.</a> (Steve Jacobsen's lab at UCLA). POSIX.<br /> <a href="http://woldlab.caltech.edu/chipseq/" target="_blank">CHiPSeq</a> - Program used by Johnson et al. (2007) in their Science publication<br /> <a href="http://tiger.dbs.nus.edu.sg/cnv-seq/" target="_blank">CNV-Seq</a> - CNV-seq, a new method to detect copy number variation using high-throughput sequencing. Chao Xie and Martti T Tammi at the National University of Singapore. Perl/R.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/findpeaks" target="_blank">FindPeaks</a> - perform analysis of ChIP-Seq experiments. It uses a naive algorithm for identifying regions of high coverage, which represent Chromatin Immunoprecipitation enrichment of sequence fragments, indicating the location of a bound protein of interest. Original algorithm by Matthew Bainbridge, in collaboration with Gordon Robertson. Current code and implementation by Anthony Fejes. Authors are from the Canada's Michael Smith Genome Sciences Centre. JAVA/OS independent. Latest versions available as part of the <a href="http://vancouvershortr.sourceforge.net/" target="_blank">Vancouver Short Read Analysis Package</a><br /> <a href="http://liulab.dfci.harvard.edu/MACS/" target="_blank">MACS</a> - Model-based Analysis for ChIP-Seq. MACS empirically models the length of the sequenced ChIP fragments, which tends to be shorter than sonication or library construction size estimates, and uses it to improve the spatial resolution of predicted binding sites. MACS also uses a dynamic Poisson distribution to effectively capture local biases in the genome sequence, allowing for more sensitive and robust prediction. Written by Yong Zhang and Tao Liu from Xiaole Shirley Liu's Lab. <br /> <a href="http://www.gersteinlab.org/proj/PeakSeq/" target="_blank">PeakSeq</a> - PeakSeq: Systematic Scoring of ChIP-Seq Experiments Relative to Controls. a two-pass approach for scoring ChIP-Seq data relative to controls. The first pass identifies putative binding sites and compensates for variation in the mappability of sequences across the genome. The second pass filters out sites that are not significantly enriched compared to the normalized input DNA and computes a precise enrichment and significance. By Rozowsky J et al. C/Perl.<br /> <a href="http://mendel.stanford.edu/sidowlab/downloads/quest/" target="_blank">QuEST</a> - Quantitative Enrichment of Sequence Tags. Sidow and Myers Labs at Stanford. From the 2008 publication <a href="http://www.ncbi.nlm.nih.gov/pubmed/18711362" target="_blank">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data</a>. (C++)<br /> <a href="http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/" target="_blank">SISSRs</a> - Site Identification from Short Sequence Reads. BED file input. Raja Jothi @ NIH. Perl.<br />SeqMap (<a href="http://biogibbs.stanford.edu/%7Ejiangh/SeqMap/" target="_blank">http://biogibbs.stanford.edu/~jiangh/SeqMap/</a>) - work like ELand, can do 3 or more bp mismatches and also insdel<br />ChIPSeq analysis is:&nbsp; <a href="http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/" target="_blank">http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/</a></p><p>See also <a href="http://seqanswers.com/forums/showthread.php?t=742" target="_blank">this thread</a> for ChIP-Seq, until I get time to update this list.<br /> <br /> <strong>Alternate Base Calling</strong><br /> <a href="http://svitsrv25.epfl.ch/R-doc/library/Rolexa/html/00Index.html" target="_blank">Rolexa</a> - R-based framework for base calling of Solexa data. Project <a href="http://www.biomedcentral.com/1471-2105/9/431" target="_blank">publication</a><br /> <a href="http://hannonlab.cshl.edu/Alta-Cyclic/main.html" target="_blank">Alta-cyclic</a> - "a novel Illumina Genome-Analyzer (Solexa) base caller"<br /> <br /> <strong>Transcriptomics</strong><br /> <a href="http://woldlab.caltech.edu/rnaseq/" target="_blank">ERANGE</a> - Mapping and Quantifying Mammalian Transcriptomes by RNA-Seq. Supports Bowtie, BLAT and ELAND. From the Wold lab.<br /> <a href="http://www.genoscope.cns.fr/externe/gmorse/" target="_blank">G-Mo.R-Se</a> - G-Mo.R-Se is a method aimed at using RNA-Seq short reads to build de novo gene models. First, candidate exons are built directly from the positions of the reads mapped on the genome (without any ab initio assembly of the reads), and all the possible splice junctions between those exons are tested against unmapped reads. From CNS in France.<br /> <a href="http://evolution.sysu.edu.cn/english/software/mapnext.htm" target="_blank">MapNext</a> - MapNext: A software tool for spliced and unspliced alignments and SNP detection of short sequence reads. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China.<br /> <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma" target="_blank">QPalma</a> - Optimal Spliced Alignments of Short Sequence Reads. Authors are Fabio De Bona, Stephan Ossowski, Korbinian Schneeberger, and Gunnar R&auml;tsch. A paper is <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma/qpalma-final.pdf" target="_blank">available</a>.<br /> <a href="http://biogibbs.stanford.edu/%7Ejiangh/rsat/" target="_blank">RSAT</a> - RSAT: RNA-Seq Analysis Tools. RNASAT is developed and maintained by Hui Jiang at Stanford University.<br /> <a href="http://tophat.cbcb.umd.edu/" target="_blank">TopHat</a> - TopHat is a fast splice junction mapper for RNA-Seq reads. It aligns RNA-Seq reads to mammalian-sized genomes using the ultra high-throughput short read aligner Bowtie, and then analyzes the mapping results to identify splice junctions between exons. TopHat is a collaborative effort between the University of Maryland and the University of California, Berkeley<br />NGS-Trex: Next Generation Sequencing Transcriptome profile explorer http://www.biomedcentral.com/1471-2105/14/S7/S10</p><p>Reference</p><p>Illumina has a software list: <a href="http://www.illumina.com/pagesnrn.ilmn?ID=245" target="_blank">http://www.illumina.com/pagesnrn.ilmn?ID=245</a>.</p><p>Some softwares in his blog (<a href="http://www.fejes.ca/labels/DNA.html" target="_blank">http://www.fejes.ca/labels/DNA.html</a>)</p><p><a href="http://seqanswers.com/wiki/Software" target="_blank">http://seqanswers.com/wiki/Software</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22807/software-packages-for-next-gen-sequence-analysis</guid>
	<pubDate>Fri, 19 Jun 2015 21:07:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22807/software-packages-for-next-gen-sequence-analysis</link>
	<title><![CDATA[Software packages for next gen sequence analysis]]></title>
	<description><![CDATA[<p><strong>Integrated solutions</strong><br /> * <a href="http://www.clcbio.com/index.php?id=1240" target="_blank">CLCbio Genomics Workbench</a> - <em>de novo</em> and reference assembly of Sanger, Roche FLX, Illumina, Helicos, and SOLiD data. Commercial next-gen-seq software that extends the CLCbio Main Workbench software. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Windows, Mac OS X and Linux.<br /> * <a href="http://g2.trac.bx.psu.edu/" target="_blank">Galaxy</a> - Galaxy = interactive and reproducible genomics. A job webportal.<br /> * <a href="http://www.genomatix.de/products/index.html" target="_blank">Genomatix</a> - Integrated Solutions for Next Generation Sequencing data analysis.<br /> * <a href="http://www.jmp.com/software/genomics/" target="_blank">JMP Genomics</a> - Next gen visualization and statistics tool from SAS. They are <a href="http://www.marketwatch.com/news/story/JMPR-Genomics-NCGR-Partnership-Foster/story.aspx?guid=%7B7AC9DE36-B6AA-4EDE-9CD5-633B29FE6154%7D" target="_blank">working with NCGR</a> to refine this tool and produce others.<br /> * <a href="http://softgenetics.com/NextGENe.html" target="_blank">NextGENe</a> - <em>de novo</em> and reference assembly of Illumina, SOLiD and Roche FLX data. Uses a novel Condensation Assembly Tool approach where reads are joined via "anchors" into mini-contigs before assembly. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Win or MacOS.<br /> * <a href="http://www.dnastar.com/products/SMGA.php" target="_blank">SeqMan Genome Analyser</a> - Software for Next Generation sequence assembly of Illumina, Roche FLX and Sanger data integrating with Lasergene Sequence Analysis software for additional analysis and visualization capabilities. Can use a hybrid templated/de novo approach. Commercial. Win or Mac OS X.<br /> * <a href="http://1001genomes.org/downloads/shore.html" target="_blank">SHORE</a> - SHORE, for Short Read, is a mapping and analysis pipeline for short DNA sequences produced on a Illumina Genome Analyzer. A suite created by the 1001 Genomes project. Source for POSIX.<br /> * <a href="http://www.realtimegenomics.com/" target="_blank">SlimSearch</a> - Fledgling commercial product.<br /> <br /> <strong>Align/Assemble to a reference</strong><br /> * <a href="https://secure.genome.ucla.edu/index.php/BFAST" target="_blank">BFAST</a> - Blat-like Fast Accurate Search Tool. Written by Nils Homer, Stanley F. Nelson and Barry Merriman at UCLA.<br /> * <a href="http://bowtie-bio.sourceforge.net/" target="_blank">Bowtie</a> - Ultrafast, memory-efficient short read aligner. It aligns short DNA sequences (reads) to the human genome at a rate of 25 million reads per hour on a typical workstation with 2 gigabytes of memory. Uses a Burrows-Wheeler-Transformed (BWT) index. <a href="http://seqanswers.com/forums/showthread.php?t=706" target="_blank">Link to discussion thread here</a>. Written by Ben Langmead and Cole Trapnell. Linux, Windows, and Mac OS X.<br /> * <a href="http://maq.sourceforge.net/" target="_blank">BWA</a> - Heng Lee's BWT Alignment program - a progression from Maq. BWA is a fast light-weighted tool that aligns short sequences to a sequence database, such as the human reference genome. By default, BWA finds an alignment within edit distance 2 to the query sequence. C++ source.<br /> * <a href="http://bioinfo.cgrb.oregonstate.edu/docs/solexa/" target="_blank">ELAND</a> - Efficient Large-Scale Alignment of Nucleotide Databases. Whole genome alignments to a reference genome. Written by Illumina author Anthony J. Cox for the Solexa 1G machine.<br /> * <a href="http://www.ebi.ac.uk/%7Eguy/exonerate/" target="_blank">Exonerate</a> - Various forms of pairwise alignment (including Smith-Waterman-Gotoh) of DNA/protein against a reference. Authors are Guy St C Slater and Ewan Birney from EMBL. C for POSIX.<br /> * <a href="http://1001genomes.org/downloads/genomemapper.html" target="_blank">GenomeMapper</a> - GenomeMapper is a short read mapping tool designed for accurate read alignments. It quickly aligns millions of reads either with ungapped or gapped alignments. A tool created by the 1001 Genomes project. Source for POSIX.<br /> * <a href="http://www.gene.com/share/gmap/" target="_blank">GMAP</a> - GMAP (Genomic Mapping and Alignment Program) for mRNA and EST Sequences. Developed by Thomas Wu and Colin Watanabe at Genentec. C/Perl for Unix.<br /> * <a href="http://dna.cs.byu.edu/gnumap/" target="_blank">gnumap</a> - The Genomic Next-generation Universal MAPper (gnumap) is a program designed to accurately map sequence data obtained from next-generation sequencing machines (specifically that of Solexa/Illumina) back to a genome of any size. It seeks to align reads from nonunique repeats using statistics. From authors at Brigham Young University. C source/Unix.<br /> * <a href="http://sourceforge.net/projects/maq/" target="_blank">MAQ</a> - Mapping and Assembly with Qualities (renamed from MAPASS2). Particularly designed for Illumina with preliminary functions to handle ABI SOLiD data. Written by Heng Li from the Sanger Centre. Features extensive supporting tools for DIP/SNP detection, etc. C++ source<br /> * <a href="http://bioinformatics.bc.edu/marthlab/Mosaik" target="_blank">MOSAIK</a> - MOSAIK produces gapped alignments using the Smith-Waterman algorithm. Features a number of support tools. Support for Roche FLX, Illumina, SOLiD, and Helicos. Written by Michael Str&ouml;mberg at Boston College. Win/Linux/MacOSX<br /> * <a href="http://mrfast.sourceforge.net/" target="_blank">MrFAST and MrsFAST</a> - mrFAST &amp; mrsFAST are designed to map short reads generated with the Illumina platform to reference genome assemblies; in a fast and memory-efficient manner. Robust to INDELs and MrsFAST has a bisulphite mode. Authors are from the University of Washington. C as source.<br /> * <a href="http://mummer.sourceforge.net/" target="_blank">MUMmer</a> - MUMmer is a modular system for the rapid whole genome alignment of finished or draft sequence. Released as a package providing an efficient suffix tree library, seed-and-extend alignment, SNP detection, repeat detection, and visualization tools. Version 3.0 was developed by Stefan Kurtz, Adam Phillippy, Arthur L Delcher, Michael Smoot, Martin Shumway, Corina Antonescu and Steven L Salzberg - most of whom are at The Institute for Genomic Research in Maryland, USA. POSIX OS required.<br /> * <a href="http://www.novocraft.com/index.html" target="_blank">Novocraft</a> - Tools for reference alignment of paired-end and single-end Illumina reads. Uses a Needleman-Wunsch algorithm. Can support Bis-Seq. Commercial. Available free for evaluation, educational use and for use on open not-for-profit projects. Requires Linux or Mac OS X.<br /> * <a href="http://pass.cribi.unipd.it/cgi-bin/pass.pl" target="_blank">PASS</a> - It supports Illumina, SOLiD and Roche-FLX data formats and allows the user to modulate very finely the sensitivity of the alignments. Spaced seed intial filter, then NW dynamic algorithm to a SW(like) local alignment. Authors are from CRIBI in Italy. Win/Linux.<br /> * <a href="http://rulai.cshl.edu/rmap/" target="_blank">RMAP</a> - Assembles 20 - 64 bp Illumina reads to a FASTA reference genome. By Andrew D. Smith and Zhenyu Xuan at CSHL. (published in BMC Bioinformatics). POSIX OS required.<br /> * <a href="http://biogibbs.stanford.edu/%7Ejiangh/SeqMap/" target="_blank">SeqMap</a> - Supports up to 5 or more bp mismatches/INDELs. Highly tunable. Written by Hui Jiang from the Wong lab at Stanford. Builds available for most OS's.<br /> * <a href="http://compbio.cs.toronto.edu/shrimp/" target="_blank">SHRiMP</a> - Assembles to a reference sequence. Developed with Applied Biosystem's colourspace genomic representation in mind. Authors are Michael Brudno and Stephen Rumble at the University of Toronto. POSIX.<br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/slider" target="_blank"><span style="text-decoration: underline;">Slider</span></a>- An application for the Illumina Sequence Analyzer output that uses the probability files instead of the sequence files as an input for alignment to a reference sequence or a set of reference sequences. Authors are from BCGSC. Paper is <a href="http://seqanswers.com/forums/showthread.php?t=740" target="_blank">here</a>.<br /> * <a href="http://soap.genomics.org.cn/" target="_blank">SOAP</a> - SOAP (Short Oligonucleotide Alignment Program). A program for efficient gapped and ungapped alignment of short oligonucleotides onto reference sequences. The updated version uses a BWT. Can call SNPs and INDELs. Author is Ruiqiang Li at the Beijing Genomics Institute. C++, POSIX.<br /> * <a href="http://www.sanger.ac.uk/Software/analysis/SSAHA/" target="_blank">SSAHA</a> - SSAHA (Sequence Search and Alignment by Hashing Algorithm) is a tool for rapidly finding near exact matches in DNA or protein databases using a hash table. Developed at the Sanger Centre by Zemin Ning, Anthony Cox and James Mullikin. C++ for Linux/Alpha.<br /> * <a href="http://socs.biology.gatech.edu/" target="_blank">SOCS</a> - Aligns SOLiD data. SOCS is built on an iterative variation of the Rabin-Karp string search algorithm, which uses hashing to reduce the set of possible matches, drastically increasing search speed. Authors are Ondov B, Varadarajan A, Passalacqua KD and Bergman NH.<br /> * <a href="http://bibiserv.techfak.uni-bielefeld.de/swift/welcome.html" target="_blank">SWIFT</a> - The SWIFT suit is a software collection for fast index-based sequence comparison. It contains: SWIFT &mdash; fast local alignment search, guaranteeing to find epsilon-matches between two sequences. SWIFT BALSAM &mdash; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. Authors are Kim Rasmussen (SWIFT) and Wolfgang Gerlach (SWIFT BALSAM)<br /> * <a href="http://synasite.mgrc.com.my:8080/sxog/NewSXOligoSearch.php" target="_blank">SXOligoSearch</a> - SXOligoSearch is a commercial platform offered by the Malaysian based <a href="http://www.synamatix.com/" target="_blank">Synamatix</a>. Will align Illumina reads against a range of Refseq RNA or NCBI genome builds for a number of organisms. Web Portal. OS independent.<br /> * <a href="http://www.vmatch.de/" target="_blank">Vmatch</a> - A versatile software tool for efficiently solving large scale sequence matching tasks. Vmatch subsumes the software tool REPuter, but is much more general, with a very flexible user interface, and improved space and time requirements. Essentially a large string matching toolbox. POSIX.<br /> * <a href="http://www.bioinformaticssolutions.com/products/zoom/index.php" target="_blank">Zoom</a> - ZOOM (Zillions Of Oligos Mapped) is designed to map millions of short reads, emerged by next-generation sequencing technology, back to the reference genomes, and carry out post-analysis. ZOOM is developed to be highly accurate, flexible, and user-friendly with speed being a critical priority. Commercial. Supports Illumina and SOLiD data.<br /> <br /> <strong><em>De novo</em> Align/Assemble</strong><br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/abyss" target="_blank">ABySS</a> - Assembly By Short Sequences. ABySS is a de novo sequence assembler that is designed for very short reads. The single-processor version is useful for assembling genomes up to 40-50 Mbases in size. The parallel version is implemented using MPI and is capable of assembling larger genomes. By Simpson JT and others at the Canada's Michael Smith Genome Sciences Centre. C++ as source. <br /> * <a href="http://www.broad.mit.edu/science/programs/genome-biology/computational-rd/computational-research-and-development" target="_blank">ALLPATHS</a> - ALLPATHS: De novo assembly of whole-genome shotgun microreads. ALLPATHS is a whole genome shotgun assembler that can generate high quality assemblies from short reads. Assemblies are presented in a graph form that retains ambiguities, such as those arising from polymorphism, thereby providing information that has been absent from previous genome assemblies. Broad Institute.<br /> * <a href="http://www.genomic.ch/edena.php" target="_blank">Edena</a> - Edena (Exact DE Novo Assembler) is an assembler dedicated to process the millions of very short reads produced by the Illumina Genome Analyzer. Edena is based on the traditional overlap layout paradigm. By D. Hernandez, P. Fran&ccedil;ois, L. Farinelli, M. Osteras, and J. Schrenzel. Linux/Win.<br /> * <a href="http://euler-assembler.ucsd.edu/portal/" target="_blank">EULER-SR</a> - Short read <em>de novo</em> assembly. By Mark J. Chaisson and Pavel A. Pevzner from UCSD (published in Genome Research). Uses a de Bruijn graph approach.<br /> * <a href="http://chevreux.org/projects_mira.html" target="_blank">MIRA2</a> - MIRA (Mimicking Intelligent Read Assembly) is able to perform true hybrid de-novo assemblies using reads gathered through 454 sequencing technology (GS20 or GS FLX). Compatible with 454, Solexa and Sanger data. Linux OS required.<br /> * <a href="http://www.seqan.de/projects/consensus.html" target="_blank">SEQAN</a> - A Consistency-based Consensus Algorithm for De Novo and Reference-guided Sequence Assembly of Short Reads. By Tobias Rausch and others. C++, Linux/Win.<br /> * <a href="http://sharcgs.molgen.mpg.de/" target="_blank">SHARCGS</a> - De novo assembly of short reads. Authors are Dohm JC, Lottaz C, Borodina T and Himmelbauer H. from the Max-Planck-Institute for Molecular Genetics.<br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/ssake" target="_blank">SSAKE</a> - The Short Sequence Assembly by K-mer search and 3' read Extension (SSAKE) is a genomics application for aggressively assembling millions of short nucleotide sequences by progressively searching for perfect 3'-most k-mers using a DNA prefix tree. Authors are Ren&eacute; Warren, Granger Sutton, Steven Jones and Robert Holt from the Canada's Michael Smith Genome Sciences Centre. Perl/Linux.<br /> * <a href="http://soap.genomics.org.cn/" target="_blank">SOAPdenovo</a> - Part of the SOAP suite. See above. <br /> * <a href="https://sourceforge.net/projects/vcake" target="_blank">VCAKE</a> - De novo assembly of short reads with robust error correction. An improvement on early versions of SSAKE.<br /> * <a href="http://www.ebi.ac.uk/%7Ezerbino/velvet/" target="_blank">Velvet</a> - Velvet is a de novo genomic assembler specially designed for short read sequencing technologies, such as Solexa or 454. Need about 20-25X coverage and paired reads. Developed by Daniel Zerbino and Ewan Birney at the European Bioinformatics Institute (EMBL-EBI). <br /> <br /> <strong>SNP/Indel Discovery</strong><br /> * <a href="http://www.sanger.ac.uk/Software/analysis/ssahaSNP/" target="_blank">ssahaSNP</a> - ssahaSNP is a polymorphism detection tool. It detects homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence numbers. More tuned for ABI Sanger reads. Developers are Adam Spargo and Zemin Ning from the Sanger Centre. Compaq Alpha, Linux-64, Linux-32, Solaris and Mac<br /> * <a href="http://bioinformatics.bc.edu/marthlab/PbShort" target="_blank">PolyBayesShort</a> - A re-incarnation of the PolyBayes SNP discovery tool developed by Gabor Marth at Washington University. This version is specifically optimized for the analysis of large numbers (millions) of high-throughput next-generation sequencer reads, aligned to whole chromosomes of model organism or mammalian genomes. Developers at Boston College. Linux-64 and Linux-32.<br /> * <a href="http://bioinformatics.bc.edu/marthlab/PyroBayes" target="_blank">PyroBayes</a> - PyroBayes is a novel base caller for pyrosequences from the 454 Life Sciences sequencing machines. It was designed to assign more accurate base quality estimates to the 454 pyrosequences. Developers at Boston College. <br /> <br /> <strong>Genome Annotation/Genome Browser/Alignment Viewer/Assembly Database</strong><br /> * <a href="http://bioinformatics.bc.edu/marthlab/EagleView" target="_blank">EagleView</a> - An information-rich genome assembler viewer. EagleView can display a dozen different types of information including base quality and flowgram signal. Developers at Boston College.<br /> * <a href="http://www.sanger.ac.uk/Software/analysis/lookseq/" target="_blank">LookSeq</a> - LookSeq is a web-based application for alignment visualization, browsing and analysis of genome sequence data. LookSeq supports multiple sequencing technologies, alignment sources, and viewing modes; low or high-depth read pileups; and easy visualization of putative single nucleotide and structural variation. From the Sanger Centre.<br /> * <a href="http://evolution.sysu.edu.cn/mapview/" target="_blank">MapView</a> - MapView: visualization of short reads alignment on desktop computer. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China. Linux.<br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/sam" target="_blank">SAM</a> - Sequence Assembly Manager. Whole Genome Assembly (WGA) Management and Visualization Tool. It provides a generic platform for manipulating, analyzing and viewing WGA data, regardless of input type. Developers are Rene Warren, Yaron Butterfield, Asim Siddiqui and Steven Jones at Canada's Michael Smith Genome Sciences Centre. MySQL backend and Perl-CGI web-based frontend/Linux. <br /> * <a href="http://staden.sourceforge.net/" target="_blank">STADEN</a> - Includes GAP4. GAP5 once completed will handle next-gen sequencing data. A partially implemented test version is available <a href="https://sourceforge.net/project/show...kage_id=256957" target="_blank">here</a><br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/xmatchview" target="_blank">XMatchView</a> - A visual tool for analyzing cross_match alignments. Developed by Rene Warren and Steven Jones at Canada's Michael Smith Genome Sciences Centre. Python/Win or Linux.<br /> <br /> <strong>Counting e.g. CHiP-Seq, Bis-Seq, CNV-Seq</strong><br /> * <a href="http://epigenomics.mcdb.ucla.edu/BS-Seq/download.html" target="_blank">BS-Seq</a> - The source code and data for the "Shotgun Bisulphite Sequencing of the Arabidopsis Genome Reveals DNA Methylation Patterning" Nature paper by <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?holding=&amp;db=pubmed&amp;cmd=search&amp;term=Shotgun%20Bisulphite%20Sequencing" target="_blank">Cokus et al.</a> (Steve Jacobsen's lab at UCLA). POSIX.<br /> * <a href="http://woldlab.caltech.edu/chipseq/" target="_blank">CHiPSeq</a> - Program used by Johnson et al. (2007) in their Science publication<br /> * <a href="http://tiger.dbs.nus.edu.sg/cnv-seq/" target="_blank">CNV-Seq</a> - CNV-seq, a new method to detect copy number variation using high-throughput sequencing. Chao Xie and Martti T Tammi at the National University of Singapore. Perl/R.<br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/findpeaks" target="_blank">FindPeaks</a> - perform analysis of ChIP-Seq experiments. It uses a naive algorithm for identifying regions of high coverage, which represent Chromatin Immunoprecipitation enrichment of sequence fragments, indicating the location of a bound protein of interest. Original algorithm by Matthew Bainbridge, in collaboration with Gordon Robertson. Current code and implementation by Anthony Fejes. Authors are from the Canada's Michael Smith Genome Sciences Centre. JAVA/OS independent. Latest versions available as part of the <a href="http://vancouvershortr.sourceforge.net/" target="_blank">Vancouver Short Read Analysis Package</a><br /> * <a href="http://liulab.dfci.harvard.edu/MACS/" target="_blank">MACS</a> - Model-based Analysis for ChIP-Seq. MACS empirically models the length of the sequenced ChIP fragments, which tends to be shorter than sonication or library construction size estimates, and uses it to improve the spatial resolution of predicted binding sites. MACS also uses a dynamic Poisson distribution to effectively capture local biases in the genome sequence, allowing for more sensitive and robust prediction. Written by Yong Zhang and Tao Liu from Xiaole Shirley Liu's Lab. <br /> * <a href="http://www.gersteinlab.org/proj/PeakSeq/" target="_blank">PeakSeq</a> - PeakSeq: Systematic Scoring of ChIP-Seq Experiments Relative to Controls. a two-pass approach for scoring ChIP-Seq data relative to controls. The first pass identifies putative binding sites and compensates for variation in the mappability of sequences across the genome. The second pass filters out sites that are not significantly enriched compared to the normalized input DNA and computes a precise enrichment and significance. By Rozowsky J et al. C/Perl.<br /> * <a href="http://mendel.stanford.edu/sidowlab/downloads/quest/" target="_blank">QuEST</a> - Quantitative Enrichment of Sequence Tags. Sidow and Myers Labs at Stanford. From the 2008 publication <a href="http://www.ncbi.nlm.nih.gov/pubmed/18711362" target="_blank">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data</a>. (C++)<br /> * <a href="http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/" target="_blank">SISSRs</a> - Site Identification from Short Sequence Reads. BED file input. Raja Jothi @ NIH. Perl.<br /> **See also <a href="http://seqanswers.com/forums/showthread.php?t=742" target="_blank">this thread</a> for ChIP-Seq, until I get time to update this list.<br /> <br /> <strong>Alternate Base Calling</strong><br /> * <a href="http://svitsrv25.epfl.ch/R-doc/library/Rolexa/html/00Index.html" target="_blank">Rolexa</a> - R-based framework for base calling of Solexa data. Project <a href="http://www.biomedcentral.com/1471-2105/9/431" target="_blank">publication</a><br /> * <a href="http://hannonlab.cshl.edu/Alta-Cyclic/main.html" target="_blank">Alta-cyclic</a> - "a novel Illumina Genome-Analyzer (Solexa) base caller"<br /> <br /> <strong>Transcriptomics</strong><br /> * <a href="http://woldlab.caltech.edu/rnaseq/" target="_blank">ERANGE</a> - Mapping and Quantifying Mammalian Transcriptomes by RNA-Seq. Supports Bowtie, BLAT and ELAND. From the Wold lab.<br /> * <a href="http://www.genoscope.cns.fr/externe/gmorse/" target="_blank">G-Mo.R-Se</a> - G-Mo.R-Se is a method aimed at using RNA-Seq short reads to build de novo gene models. First, candidate exons are built directly from the positions of the reads mapped on the genome (without any ab initio assembly of the reads), and all the possible splice junctions between those exons are tested against unmapped reads. From CNS in France.<br /> * <a href="http://evolution.sysu.edu.cn/english/software/mapnext.htm" target="_blank">MapNext</a> - MapNext: A software tool for spliced and unspliced alignments and SNP detection of short sequence reads. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China.<br /> * <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma" target="_blank">QPalma</a> - Optimal Spliced Alignments of Short Sequence Reads. Authors are Fabio De Bona, Stephan Ossowski, Korbinian Schneeberger, and Gunnar R&auml;tsch. A paper is <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma/qpalma-final.pdf" target="_blank">available</a>.<br /> * <a href="http://biogibbs.stanford.edu/%7Ejiangh/rsat/" target="_blank">RSAT</a> - RSAT: RNA-Seq Analysis Tools. RNASAT is developed and maintained by Hui Jiang at Stanford University.<br /> * <a href="http://tophat.cbcb.umd.edu/" target="_blank">TopHat</a> - TopHat is a fast splice junction mapper for RNA-Seq reads. It aligns RNA-Seq reads to mammalian-sized genomes using the ultra high-throughput short read aligner Bowtie, and then analyzes the mapping results to identify splice junctions between exons. TopHat is a collaborative effort between the University of Maryland and the University of California, Berkeley</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>