<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/31976?offset=290</link>
	<atom:link href="https://bioinformaticsonline.com/related/31976?offset=290" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</guid>
	<pubDate>Sun, 25 Jun 2017 17:52:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</link>
	<title><![CDATA[Bio-Graphics-2.37]]></title>
	<description><![CDATA[<p>BioPerl modules&nbsp;<a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/lib/Bio/Graphics.pm">Bio::Graphics</a>&nbsp;+&nbsp;<a href="http://search.cpan.org/~cjfields/BioPerl-1.6.923/Bio/DB/GFF.pm">Bio::DB:GFF</a>&nbsp;and example scripts. It can draw some of the (but not all) feature types GBrowse can draw. This script should contain everything you can probably make use of (e.g. transcripts, segments, etc.) and you can try to find a good way of visualization by experimenting with its options.</p>
<p>http://search.cpan.org/~lds/Bio-Graphics-2.37/</p><p>Address of the bookmark: <a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/" rel="nofollow">http://search.cpan.org/~lds/Bio-Graphics-2.37/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/11107/the-minerva-research-group-for-bioinformatics</guid>
  <pubDate>Tue, 27 May 2014 15:48:14 -0500</pubDate>
  <link></link>
  <title><![CDATA[The Minerva Research Group for Bioinformatics]]></title>
  <description><![CDATA[
<p>The focus of the bioinformatics group is to use computational approaches to gain an insight into genome evolution in primates.</p>

<p>http://www.eva.mpg.de/genetics/bioinformatics/overview.html?Fsize=0%2C%20%40%2F%27</p>

<p>Kelso Group<br />Department of Evolutionary Genetics<br />Max Planck Institute for Evolutionary Anthropology<br />Deutscher Platz 6<br />04103 Leipzig<br />Germany<br />Phone: +49 341 3550 500</p>

<p>Job: <br />http://www.eva.mpg.de/genetics/bioinformatics/jobs.html?Fsize=0%2C%2B%40</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11582/monitor-running-jobs-on-linux-server</guid>
	<pubDate>Fri, 06 Jun 2014 16:18:43 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11582/monitor-running-jobs-on-linux-server</link>
	<title><![CDATA[Monitor running jobs on Linux server]]></title>
	<description><![CDATA[<p>You as a bioinformatican run lots of program on your servers. Sometime the shared server is also used by your colleague. If server is busy you sometime need to check the running programs and want to monitor the running programs as well. The "top" command will come in handy when you need to find out if things are still running, how long they&rsquo;ve been running, or how much memory is being used.<br /><br />&lsquo;top&rsquo; is very simple to run: type<br /><br />%% top<br /><br />You&rsquo;ll get a screen that looks like this, and is updated regularly:<br /><br /><img src="http://bioinformaticsonline.com/mod/photo/top.png" width="659" height="582" alt="image" style="border: 0px;"><br />Simple, right? Heh.<br /><br />First! Note that you can use &lsquo;q&rsquo; or &lsquo;CTRL-C&rsquo; to exit from &lsquo;top&rsquo;.<br /><br />Now let&rsquo;s read and understand at each line independently.<br /><br />The first line:<br /><br />top - 23:00:48 up 39 days,&nbsp; 2 user,&nbsp; load average: 0.00, 0.00, 0.00<br /><br />The first line tells you the current time, how long the machine has been up, how many users are logged in, and the short/medium/long-term compute load on the machine. If you run something for a long time, you&rsquo;ll see these numbers go up. Right now, the machine is basically just sitting there, so these are all close to 0.<br /><br />The second line:</p><p>Tasks:&nbsp; 239 total,&nbsp;&nbsp; 1 running,&nbsp; 238 sleeping,&nbsp;&nbsp; 0 stopped,&nbsp;&nbsp; 0 zombie<br /><br />This line tells you how many processes are running. If you are using laptops machines it&rsquo;s not so interesting because you really are the only one using this machine.<br /><br />Cpu(s):&nbsp; 0.0%us,&nbsp; 0.0%sy,&nbsp; 0.0%ni,100.0%id,&nbsp; 0.0%wa,&nbsp; 0.0%hi,&nbsp; 0.0%si,&nbsp; 0.0%st<br /><br />This line contains the CPU load. The first two numbers are how busy the system is doing computation (&ldquo;us&rdquo; stands for &ldquo;user&rdquo;) and how busy the system is doing system-y things like accessing disks or network (&ldquo;sy&rdquo; stands for &ldquo;system&rdquo;). We&rsquo;ll talk more about this later.<br /><br />Mem:&nbsp;&nbsp; 49457320k total,&nbsp;&nbsp;&nbsp; 3492174k used,&nbsp; 14535596k free,&nbsp;&nbsp;&nbsp; 1435148k buffers<br /><br />This should be easy to understand &ndash; how much memory you&rsquo;re using! <br /><br />Swap:&nbsp;&nbsp; 539356k total,&nbsp;&nbsp; 28332k used,&nbsp;&nbsp; 836562k free,&nbsp;&nbsp;&nbsp; 29862014k cached<br /><br />Swap is just on-disk memory that can be used to &ldquo;swap&rdquo; out programs from main memory. Again, we&rsquo;ll talk about this later.:<br /><br />PID USER&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; PR&nbsp; NI&nbsp; VIRT&nbsp; RES&nbsp; SHR S %CPU %MEM&nbsp;&nbsp;&nbsp; TIME+&nbsp; COMMAND<br />&nbsp; 1 root&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 39 &nbsp; 19&nbsp; 0&nbsp; 0&nbsp; 0 S&nbsp; 0.0&nbsp; 0.0&nbsp;&nbsp; 246:57.22 kipmi0<br />&nbsp; 2 root&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; RT&nbsp;&nbsp; 0&nbsp;&nbsp;&nbsp;&nbsp; 0&nbsp;&nbsp;&nbsp; 0&nbsp;&nbsp;&nbsp; 0 S&nbsp; 0.0&nbsp; 0.0&nbsp;&nbsp; 0:00.00 migration/0<br /><br />And... finally! What&rsquo;s actually running! The two most important numbers are the %CPU and %MEM towards the right, as well as the COMMAND. This tells you how compute- and memory-intensive your program is. Right now, nothing&rsquo;s running so the numbers aren&rsquo;t very interesting, but just wait until we run something...</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11355/genomics-and-personalized-medicine-breakthroughs</guid>
	<pubDate>Sun, 01 Jun 2014 23:40:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11355/genomics-and-personalized-medicine-breakthroughs</link>
	<title><![CDATA[Genomics and Personalized Medicine Breakthroughs]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/VAR-1vNc0TE" frameborder="0" allowfullscreen></iframe>http://bit.ly/e8QGzY Human genome mapping is now enabling a breakthrough in medical innovation -- personalized medicine. What does this mean for patients? We can now identify predispositions to disease, predict how we metabolize drugs, and figure out what kinds of treatments we may respond to, and even determine when a drug may give us an adverse reaction. All medical specialties benefit from human genome intelligence -- oncology saw the first impacts -- but advances are now being seen in cardiology, obstetrics and gynecology, pediatric diseases, gastroenterology, rheumatology, immunology and other areas. This video covers the areas that genetic medicine is impacting and where the future of genomic medicine is heading.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</guid>
	<pubDate>Tue, 28 Jan 2020 05:37:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</link>
	<title><![CDATA[The Raku Programming Language]]></title>
	<description><![CDATA[<p><span>Raku is a member of the Perl family of programming languages. Formerly known as Perl 6, it was renamed in October 2019. Raku introduces elements of many modern and historical languages. Compatibility with Perl was not a goal, though a compatibility mode is part of the specification.</span><span>&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://www.raku.org/">https://www.raku.org/</a></span></p><p>Address of the bookmark: <a href="https://www.raku.org/" rel="nofollow">https://www.raku.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11441/assistant-professor-in-bioinformatics-at-dr-d-y-patil-biotechnology-bioinformatics-institute</guid>
  <pubDate>Tue, 03 Jun 2014 19:54:15 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor 	in Bioinformatics at Dr. D. Y. Patil Biotechnology &amp; Bioinformatics Institute]]></title>
  <description><![CDATA[
<p>Dr. D. Y. Patil Biotechnology &amp; Bioinformatics Institute <br />Tathawade, Pune 411033.</p>

<p>Assistant Professor 	in Bioinformatics </p>

<p>Essential :<br />First Class Master’s Degree in the appropriate branch of Life Sciences / Technology (Tech.)<br />OR<br />Ph.D in Life Sciences or in the respective subject area of specialization<br />OR<br />Good Academic record with at least 55% marks (or an equivalent grade) at the Master’s Degree level, in the relevant subject or an equivalent degree from an Indian / Foreign University.<br />Besides fulfilling the above qualifications, candidates should have cleared the eligibility test (NET) for lecturers conducted by the UGC, CSIR or similar test accredited by the UGC and as per the requirements of UGC guidelines.</p>

<p>Desirable :<br />Teaching, research industrial and/or professional experience in a reputed organization. <br />Papers presented at Conferences and/or in refereed journals</p>

<p>Note : Application are invited in prescribed form Click here for Application Form<br />Kindly send your applications to “Registrar, Dr. D. Y. Patil Vidyapeeth, Pune, Sant Tukaram Nagar, Pimpri, Pune – 411018., Maharashtra, India.” should reach in the University office within 15 days from the publication.</p>

<p>More Info: http://www.dpu.edu.in/BiotechResearchPositions.aspx</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42921/run-bash-script-in-perl-program</guid>
	<pubDate>Sat, 27 Feb 2021 01:42:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42921/run-bash-script-in-perl-program</link>
	<title><![CDATA[Run bash script in Perl program !]]></title>
	<description><![CDATA[<p>BioPerl is a compilation of Perl modules that can be used to build bioinformatics-related Perl scripts. It is used, for example, in the development of source codes, standalone software/tools, and algorithms in bioinformatics programmes. Different modules are easy to instal and include, making it easier to perform different functions. Despite the fact that Python is commonly favoured over Perl, some bioinformatics software, such as the standalone version of 'alienomics', is written in Perl. Often it's a major problem for beginners to execute certain Unix/shell commands in Perl script, so it's hard to determine which feature is unique to a situation.</p><div style="background-color: white;">Perl provides various features and operators for the execution of external commands (described as follows), which are unique in their own way.</div><div style="background-color: white;">&nbsp;</div><div style="background-color: white;">They vary slightly from one another, making it difficult for Perl beginners to choose between them.</div><div style="background-color: white;">&nbsp;</div><div style="background-color: white;"><strong>1. IPC::Open2</strong></div><p>More at https://bioinformaticsonline.com/snippets/view/42919/perl-ipcopen2-module</p><p><strong>2. exec&rdquo;&rdquo;</strong></p><p><em>&nbsp;syntax:&nbsp;</em><code>exec "command";</code></p><div style="background-color: #edfbff;">It's a Perl function (perlfunc) that executes a command but never returns, similar to a function's return statement.</div><div style="background-color: white;">While running the command, it keeps processing the script and does not wait until it finishes first, returns false when the command is not found, but never returns true.</div><p><strong>3. Backticks &ldquo; or qx//</strong></p><p><em>syntax:&nbsp;</em><code>`command`;</code></p><p><em>syntax:&nbsp;</em><code>qx/command/;</code></p><div style="background-color: white;">It's a Perl operator (perlop) that executes a command and then resumes the Perl script once the command has ended, but the return value is the command's STDOUT.</div><p><strong>4. IPC::Open3</strong></p><p><em>syntax:&nbsp;</em><code>$output =&nbsp;open3(\*CHLD_IN, \*CHLD_OUT, \*CHLD_ERR,&nbsp;'command arg1 arg2', 'optarg',...);</code></p><p style="text-align: justify;"><code></code>It is very similar to <code>IPC::Open2</code> with the capability to capture all three file handles of the process, i.e., STDIN, STDOUT, and STDERR. It can also be used with or without the shell. You can read about it more in the documentation: <a href="https://perldoc.perl.org/IPC/Open3.html" target="_blank">IPC::Open3</a>.</p><p><code>$output = open3(my $o ut,&nbsp;my $in, 'command arg1 arg2');</code></p><p>OR without using the shell</p><p><code>$output = open3(my $out,&nbsp;my $in, 'command', 'arg1', 'arg2');</code></p><p><strong>5.a2p</strong></p><p><em>syntax:&nbsp;</em><code>a2p [options] [awkscript]</code></p><p>There is a Perl utility known as <code>a2p</code> which translates <code>awk</code> command to Perl. It takes awk script as input and generates a comparable Perl script as the output. Suppose, you want to execute the following <code>awk</code> statement</p><p><code>awk '{$1 = ""; $2 = ""; print}' f1.txt</code></p><p>This statement gives error sometimes even after escaping the variables (\$1, \$2) but by using <code>a2p</code> it can be easily converted to Perl script:</p><p>For further information, you can read it&rsquo;s documentation: <code><a href="https://perldoc.perl.org/a2p.html" target="_blank">a2p</a></code></p><p>More help at https://bioinformaticsonline.com/snippets/view/42920/perl-script-to-run-awk-inside-perl</p><p><strong>6. system()</strong></p><p><em>syntax:&nbsp;</em><code>system( "command" );</code></p><p>It is also a Perl function (<a href="https://perldoc.perl.org/functions/system.html" target="_blank">perlfunc</a>) that executes a command and waits for it to get finished first and then resume the Perl script. The return value is the exit status of the command. It can be called in two ways:</p><p><code>system( "command arg1 arg2" );</code></p><p>OR</p><p><code>system( "command", "arg1", "arg2" );</code></p><p>HELP</p><p>Here are some useful Perl cheat sheets that can be used as a quick reference guide.--&nbsp;<a href="https://www.pcwdld.com/perl-cheat-sheet" target="_blank">https://www.pcwdld.com/perl-cheat-sheet</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11656/faculty-post-at-zhejiang-university</guid>
  <pubDate>Tue, 10 Jun 2014 03:40:40 -0500</pubDate>
  <link></link>
  <title><![CDATA[Faculty post at Zhejiang University]]></title>
  <description><![CDATA[
<p>Zhejiang University (ZJU) is seeking faculty candidates for its newly launched, highly competitive and well funded “Hundred Talents Program”. This search covers all colleges and departments at ZJU. Applicants, expected to be about 35 years old, should hold PhD degree, and postdoctoral experiences are preferred for applicants in most fields. Applicants should have demonstrated commitment to excellence in teaching and research at a level comparable to the academic achievement of assistant professor or associate professor in world-renowned universities. Successful candidates must work full-time and are expected to establish internationally competitive and independent research program in cutting-edge areas of the relevant field at ZJU.</p>

<p>As one of the leading research-intensive universities in China, ZJU is located in the beautiful city of Hangzhou. Successful candidates will be employed as Principal Investigators and are qualified to supervise doctoral students. ZJU will offer an internationally competitive salary and the opportunity to purchase university's apartment at a price much lower than the market price, and will provide office and laboratory spaces as well as internationally competitive research startup packages.</p>

<p>Qualified applicants are strongly encouraged to submit their applications electronically to tr@zju.edu.cn. Applicants should include the following materials in pdf format: a comprehensive CV, a statement of research and teaching plan, and a list of 3 to 5 references with detailed contact information.</p>

<p>Contact：Talents Office, ZJU</p>

<p>Tel：+86-571-88981345, +86-571-88981390</p>

<p>Fax：+86-571-88981976</p>

<p>E-mail:tr@zju.edu.cn</p>
]]></description>
</item>

</channel>
</rss>