<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32152?offset=280</link>
	<atom:link href="https://bioinformaticsonline.com/related/32152?offset=280" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4193/bioinformatics-101-running-blast</guid>
	<pubDate>Tue, 03 Sep 2013 14:59:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4193/bioinformatics-101-running-blast</link>
	<title><![CDATA[Bioinformatics 101 -  Running BLAST]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/CYnjROfGXv8" frameborder="0" allowfullscreen></iframe>How to format the database for BLAST, run the command, view the output file, and use BioPerl and Perl to parse the output. By David Francis, Ohio State University. Delivered live at the Tomato Disease Workshop 2010. For more information, please visit http://www.extension.org/pages/32521/bioinformatics-101-video.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4081/csir-institute-of-genomics-integrative-biology</guid>
  <pubDate>Thu, 29 Aug 2013 05:22:03 -0500</pubDate>
  <link></link>
  <title><![CDATA[CSIR-INSTITUTE OF GENOMICS &amp; INTEGRATIVE BIOLOGY]]></title>
  <description><![CDATA[
<p>CSIR-INSTITUTE OF GENOMICS &amp; INTEGRATIVE BIOLOGY, Mall Road, Delhi 110007</p>

<p>POSITIONS OPEN FOR TEMPORARY RESEARCH PROJECT POSTS</p>

<p>(Date of interview 23rd September 2013 at 10:30 AM)</p>

<p>CSIR-Institute of Genomics &amp; Integrative Biology (IGIB), desires to engage qualified incumbents on purely temporary basis as detailed below:</p>

<p>Project Code/Title (Project Code BSC0123)</p>

<p>Genome dynamics in Cellular Organization, Differentiation and Enantiostasis (GENCODE)</p>

<p>Project Fellow<br />	<br />First Class M.Sc./M.Tech in bioinformatics/Human Genetics/Genomics</p>

<p>Rs. 16,000/- + 30 % HRA per month</p>

<p>Sr. Project Fellow	</p>

<p>First Class M.Sc./M.Tech in bioinformatics/Human Genetics/Genomics</p>

<p>With two years of experience in NGS data analysis.</p>

<p>Rs. 18,000/- + 30 % HRA per month</p>

<p>Age relaxation as per Govt. of India instructions.</p>

<p>Engagement is for the project and on behalf of the funding agency and the tenure shall be as mentioned above. The duration of the post is initially for One year or till the closing date of the project, whichever is earlier. Tenure may be extendable up to project duration. Contract may be terminated at any time by giving one-month notice by either side. The applicants will have no claim implicit or explicit for consideration against any CSIR/IGIB post.</p>

<p>How to Apply:</p>

<p>It is mandatory for eligible applicants to apply by both the processes as given below:</p>

<p>1.    Sending the resume in MS Word format directly to hrd@igib.res.in (Mentioning the Project Code-Post Code in the Subject Line of the email example:GAP0059-1)</p>

<p>2.    They also need to fill up proforma by clicking on the following link HR Online Form.</p>

<p>3.    Candidate cannot apply for more than two posts.</p>

<p>Last date of receiving application is 02-09-2013.</p>

<p>No application would be entertained with result awaited status or after due date.</p>

<p>The email will be sent to the short listed candidates.</p>

<p>No TA/DA will be paid to the candidates to attend the interview. The engagement shall be as per guidelines of CSIR/Funding agency. Candidates will have an option to give reply in Hindi.</p>

<p>Note: The shortlisted candidates, who will receive the email for interview, have to report at 09:00 AM on the day of interview along with any Photo ID card and original certificates for entry purpose. Entry will be closed by 10:00 AM.</p>

<p>More @ http://www.igib.res.in/sites/default/files/23092013.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/3013/python-and-biopython-tutorial</guid>
	<pubDate>Fri, 23 Aug 2013 06:47:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/3013/python-and-biopython-tutorial</link>
	<title><![CDATA[Python and BioPython Tutorial]]></title>
	<description><![CDATA[<p>A quickstart tutorial that allows to become familiar with the Python language. The exercises expect knowledge of basic concepts of programming. A group of 2nd year computer science students with no previous Python knowledge required 60'-90' to complete the exercises. With about 3 hours time, the exercise is suitable for non-programmers as well.</p><p>Address of the bookmark: <a href="http://www.biotnet.org/training-materials/python-programmers" rel="nofollow">http://www.biotnet.org/training-materials/python-programmers</a></p>]]></description>
	<dc:creator>Manshi Raghubanshi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/3967/research-project-posts-for-csir-project-delhi</guid>
  <pubDate>Tue, 27 Aug 2013 04:31:41 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Project Posts for CSIR Project, Delhi]]></title>
  <description><![CDATA[
<p>Positions Open For Temporary Research Project Posts for CSIR Project, Delhi<br />CSIR is looking for bright young candidates to get involved in building algorithms and platforms for large biological data analyses in the areas of comparative genomics, computational workflows, disease association studies, simulating virtual organelles, etc. Anyone who fulfills the eligibility criteria mentioned below may appear for a walk-in interview on 3rd September 2013 at CSIR Headquarters, Anusandhan Bhawan, 2 Rafi Marg, Delhi – 110001.<br />you can go to link for details or download PDF</p>

<p>http://www.csir.res.in/External/Heads/aboutcsir/announcements/ProjectPost_130813.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/4098/bioinformatics-algorithm-demonstrations-and-tutorials</guid>
	<pubDate>Thu, 29 Aug 2013 09:23:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/4098/bioinformatics-algorithm-demonstrations-and-tutorials</link>
	<title><![CDATA[Bioinformatics Algorithm Demonstrations and Tutorials]]></title>
	<description><![CDATA[<p>Abstract</p>
<p>This project presents demonstrations of selected computer science algorithms important in&nbsp;bioinformatics, implemented in the spreadsheet program Microsoft Excel. Spreadsheets provide an&nbsp;interesting platform for demonstration of algorithms, since various steps of the calculations can be&nbsp;exposed in a manner that is easily comprehensible to users with little programming experience. The&nbsp;algorithms demonstrated include two approaches to approximate string matching (dynamic programming&nbsp;and Shift-AND numeric approximate matching), Hierarchical Clustering (used in phylogenetic studies&nbsp;and microarray analysis of gene expression), a Naive Bayes Classifier for simulated microarray gene&nbsp;expression data, and a simple Neural Network. These demonstrations are designed to serve as&nbsp;instructional aids in bioinformatics courses.</p>
<p>Tutorial @&nbsp;http://www.cybertory.org/downloads/bae/BioinformaticsAlgorithmsInExcel.zip</p>
<p>One of the best resource for online bioinformatics learning is https://stepic.org/Bioinformatics-Algorithms-2 Enjoy the online learning.</p>
<p>Reference :&nbsp;cybertory</p>
<blockquote>
<p><span>" Please add your favourite bioinformatics algorithms and tutorial links below in the comment section, for the benefit of bioinformatics and computational biology community ".&nbsp;</span></p>
</blockquote><p>Address of the bookmark: <a href="http://www.cybertory.org/downloads/bae/BioinformaticsAlgorithmsExcelDoc.pdf" rel="nofollow">http://www.cybertory.org/downloads/bae/BioinformaticsAlgorithmsExcelDoc.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>