If you are interested in gene prediction, have a look at GenomeThreader.

Address of the bookmark: http://genometools.org/

This job will allow the intern to become more familiar with new biological and bioinformatics tools like next generation sequencing, RNA-Seq data analysis and comparative genomics.

To apply for this position, send the following documents (in PDF format) to Dr Pierre-Yves Dupont (email p.y.dupont@massey.ac.nz):

1. A short cover letter.
2. A curriculum vitae, with transcript details.
3. The names and contact details of two referees willing to provide a confidential letter of recommendation upon request.

Informal enquiries are welcome. Formal applications are due by Sunday 2nd December 2012.
Requirements:

This position requires a good understanding of genetic problems, a good command of at least one scripting language (Perl, Python...), a basic knowledge of MySQL or any relational database management system. Knowledge in biological programming libraries (BioPython, BioPerl, BioRuby...), Java, C++ or any compiled language is an asset but not required. Undergraduate or Master degree is required.
Contact Information:

Dr. Pierre-Yves Dupont
Institute of Molecular BioSciences
Massey University
Private Bag 11 222
Palmerston North 4442
NEW ZEALAND

http://massey.genomicus.com/
p.y.dupont@massey.ac.nz

Information about the Institute of Molecular BioSciences (http://imbs.massey.ac.nz/) and the Computational Biology Research Group (http://massey.genomicus.com/) is available online. For more information about the position, you can contact Dr Pierre-Yves Dupont (email p.y.dupont@massey.ac.nz).

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

The candidate will be mainly in charge of developing research on Gene Expression/SNP Arrays data, NGS whole -exome and -transcriptome datasets and biological networks in the contexts of genetic diseases, innovative therapies and regenerative medicine. Main activities will be: (i) data analysis (short-reads mapping, genomics aberrations discovery and annotation, variants pathogenicity detection); (ii) functional/pathway enrichment analysis; (iii) biological networks analysis (artificial knockout, redundancy and lethality analysis, gene set essentiality); (iv) developing of ad-hoc software solutions/routines on clusters of CPUs and GPUs.

The correct cultural background (training in Biology / Computer Science / Statistics or a mix of the three) and a strong interest in working in high throughput data analysis will be considered at the same level of specific experience in the above-mentioned fields.

Knowledge of molecular modeling and simulation and willingness to learn one or more of these languages: python, perl, R, Java, C++, C# is a golden plus. Good knowledge of Scientific English will be positively evaluated for this position, together with good presentation and teamwork skills.

Candidates should send:
• a cover letter explaining the role they would like to undertake within the Center, even if it is not listed in this job adv, stating clearly why they would be a good fit to the proposed role, and what they would bring to the Center in terms of expertise, ideas, talent;
• a CV including a list of publications;
• List of referees.

A CV with one professional reference, details on educational background and of the biological and/or bioinformatic and/or data analysis skills and experience should be sent by email for a preliminary selection to: Tommaso Mazza t.mazza@css-mendel.it

Adv. No. URDIP/ 6/2014

Opportunity for young Bioinformatics Professionals to make a career in the area of Intellectual Property CSIR has set up a Unit for Research and Development of Information Products (CSIR-URDIP) at Pune to work in the area of scientific informatics. One of the major focus areas of research work at CSIR-URDIP is PATENT INFORMATICS. With the increasing applications of Bioinformatics in the areas of life sciences industry such as Agriculture and Health Care (Diagnostics and Drugs), the output of research in these area is being protected by different forms of Intellectual Property rights. Realizing the importance of IP in the Bioinformatics field, Department of Biotechnology (DBT) has sanctioned a project on “Development, Facilitation and Harvesting of Bioinformatics related Intellectual Property” at CSIR-URDIP.

The project will involve application of Patent Informatics tools and techniques to Bioinformatics (including creation of patent landscapes, preparation of techno-legal reports of patentability, freedom to operate studies) to help protect IPRs and develop and conduct training programmes on IPRs related to Bioinformatics.

CSIR-URDIP invites applications from young Bioinformatics professionals to work on this emerging area which offers challenging opportunities and attractive career possibilities in future.

Position I: Research Associate

No of Positions: One

Consolidated amount Payable: Rs. 22,000/- per month + 20% HRA= Rs.26,400

Qualification: PhD in Bioinformatics. In exceptional cases, candidature of M. Tech. candidates with First class in Bioinformatics with three years of relevant work experience will also be considered.

Age Limit: 35 years. The age should not exceed the limit indicated as on a closing date of receipt of completed application form.

Upper age limit is relaxable for 5 years for SC/ST, OBC, Physically handicapped and female candidates as per CSIR/Government of India rules.

Position II: Junior Research Fellow

No of Positions: one

Consolidated amount Payable: Rs. 16,000/- + 20% HRA = 19,200

Qualification: M.Sc / BE or equivalent in Bioinformatics with minimum of 55% marks in aggregate Job requirement: Scientific literature and patent search, analysis and Report Writing

Preference: Preference will be given to candidates with knowledge of patents and or 1-2 years of experience + Knowledge of Computers (MS Excel + Word Processing)

Age Limit: 28 years. The age should not exceed the limit indicated as on a closing date of receipt of completed application form.

For details please visit our website (www.urdip.res.in/careers) for further details and apply online by 30th September, 2014.

Advertisement: http://www.urdip.res.in/download/Advt6_2014.pdf

Address of the bookmark: https://arvados.org/

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

a) M.Sc/or equivalent in biological sciences/related areas [Position Code: PA_JRF_PF_a]
b) B.E/B.Tech/ M.Sc in biotechnology/bioinformatics/computer science/Chemistry/Physics or MCA [Position Code: PA_JRF_PF_b]
c) M.Sc/or equivalent in wildlife sciences/ecology/environmental sciences or MBBS/BVSc/MVSc. [Position Code: PA_JRF_PF_c]

(Candidates with result awaited are NOT eligible to apply)

Upper Age limit 28years

Rs.12000 / Rs.16000 (as sanctioned by the funding agency)

2. Post Doctoral Fellow/Research Associate in multiple research areas [PDF_RA]

Ph.D. (submitted/awarded) in any branch of biological Sciences. Candidates with Ph.D. in other sciences are also encouraged to apply.

Experience in molecular biology, biochemistry, structural biology, cell biology, infectious disease, conservation genetics, veterinary science, reproductive biology, and molecular diagnostics is desired but not mandatory.

[Position Code: PDF_RA]

UpperAge limit 35years

Rs. 22000- 26000 (as sanctioned by the funding agency)

3. Post Doctoral Scientist Fellow [PDSF]

Ph.D in any of the following areas: bioinformatics, next generation sequencing, high throughput data analysis, proteomics, bio-statistics, computer science, information technology, computer hardware and networking/clustering, parallel processing.
[Position Code: PDSF]

Upper Age limit 40 years

Rs. 40000 consolidated (as sanctioned by the funding agency)

Download Application: Last date for apply online: 09th Oct 2014

Advertisement: www.ccmb.res.in//index.php?view=notifications&mid=0&id=71&nid=38

Apply online http://www.ccmb.res.in/positions/temp_notif/online_form.html

More at http://www.ccmb.res.in//index.php?view=notifications&mid=0&id=71&nid=38