<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32190?offset=880</link>
	<atom:link href="https://bioinformaticsonline.com/related/32190?offset=880" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6961/research-assistant-national-bureau-of-animal-genetic-resources</guid>
  <pubDate>Tue, 03 Dec 2013 06:17:34 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Assistant @ NATIONAL BUREAU OF ANIMAL GENETIC RESOURCES]]></title>
  <description><![CDATA[
<p>NATIONAL BUREAU OF ANIMAL GENETIC RESOURCES<br />Near Basant Vihar G.T. Road Bypass<br />P.O. Box No.129, Karnal-132001 (Haryana)</p>

<p>WALK-IN-INTERVIEW</p>

<p>A walk-in-Interview is proposed to be held at National Bureau of Animal Genetic Resources, Karnal (Haryana)-132001 at 11:30 AM on 18.12.2013 to select One RA and One SRF as per details given below:</p>

<p>1. One post of Research Associate under DBT sponsored Support under BIPP for the “SanGenix: A comprehensive Next Generation Sequence (NGS) data analysis solution” as Grants in AID. Thepost duration is Upto 31st March 2015 or earlier.</p>

<p>2. One post of Senior Research Fellow under NAIP (Component-4) Bioprospecting of genes and allele mining for abiotic stress tolerance. The post duration is Upto 31st March 2014 or earlier</p>

<p>Essential Qualifications: Ph.D. in Bioinformatics/ Computer Application or<br />First Class Masters degree in Bioinformatics/ Computer Application with two years experience as evidenced by Publications.</p>

<p>Desirable: Experience in the field of handling Next generation Sequencing Data.</p>

<p>Emolument: Rs. 22,000/- per month + HRA as per admissibility</p>

<p>Age Limit:</p>

<p>40 years for Men<br />45 years for women as on date of interview</p>

<p>Research Associate: ONE</p>

<p>Duration of engagement: Upto</p>

<p>31st March 2015 or earlier &amp; Coterminus with the project</p>

<p>Responsibilities: To help the PI for Beta testing and development of the SanGenix Tool for NGS data.</p>

<p>Essential Qualifications: First Class Masters’ degree in Bioinformatics/Biotechnology.</p>

<p>Desirable: Experience in the field of Biotechnology/ Bioinformatics</p>

<p>Emoluments:</p>

<p>Rs. 16,000/- per month + HRA as per admissibility.<br />Senior Research Fellow: ONE<br />Duration of engagement: Upto 31st March 2014 or earlier &amp; Coterminus with the project</p>

<p>Age Limit</p>

<p>35 years for men<br />40 years for women as on date of interview</p>

<p>Note: Relaxation in age will be admissible for SC/ST &amp; OBC candidates as per Govt. of India /ICAR norms</p>

<p>1. The applicants must bring with them original documents and brief of research work done during post graduation along with a set of photocopy and latest two passport size photographs.<br />2. A panel of selected candidates will also be made which may be utilized for filling of positions of shorter durations in future if demand arises.<br />3. Experience certificate in original, if any 4. The above positions are purely on temporary basis and are co-terminus with the project. No TA/DA will be paid to attend the interview.<br />5. Any other clarifications can be had on the date of interview.<br />6. The Director’s decision will be final and binding on all respects.</p>

<p>Advertisement: http://210.212.93.85/rasrfadvertise.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4655/mathivanan-lab</guid>
  <pubDate>Fri, 20 Sep 2013 13:09:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Mathivanan Lab]]></title>
  <description><![CDATA[
<p>The major research interests are in exploring the role of extracellular matrix components (soluble secreted proteins and membrane vesicles) in cancer and intercellular communication. The lab integrates proteomic, genomic and bioinformatics methodologies to explore cancer cells. </p>

<p>More at http://www.mathivananlab.org/index.html</p>

<p>http://scholar.google.com/citations?user=U6PyEdYAAAAJ&amp;hl=en</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4706/junior-research-fellow-iit</guid>
  <pubDate>Sat, 21 Sep 2013 18:04:50 -0500</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow @ IIT]]></title>
  <description><![CDATA[
<p>Applications are invited from the citizens of India for filling up the following temporary position for the sponsored project undertaken in the Department of Biosciences and Bioengineering of this Institute. The position is temporary initially for a period of  1 Year  and tenable only for the duration of the project. The requisite qualification &amp; experience etc. are given below:<br /> <br />Project Code, Project Title &amp; Funding Agency<br />13DST016 : "Studies on the component of mimivirus DNA replication machinery" (Department of Science &amp; Technology)<br /> <br />Position &amp; Salary	<br />Junior Research Fellow (1 Post )<br />Consolidated salary <br /> Rs.16000/- p.m. + HRA<br />Qualification	<br />MSc or MTech or BTech or BE in one of the following branches with first class-Biochemistry, Microbiology, genetic Engineering, Biotechnology, Medical Microbiology, Bioinformatics, life sciences etc.<br />Job Profile	<br />Project involves virus culturing and purification, cloning, protein purification and measurement of helicase, primase, nuclease, translocase activities using various methods. Person should be highly motivated and some experience in cloning and protein purification is desirable. Experience in handling insect cell lines will be an added advantage.</p>

<p>More at http://www.ircc.iitb.ac.in/IRCC-Webpage/rnd/RecruitmentGenerateCircular.jsp?srno=2013086</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4728/3-days-intensive-course-on-understanding-omics-data-in-basel-switzerland-19-21st-november</guid>
  <pubDate>Mon, 23 Sep 2013 10:46:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[3 days intensive course on Understanding 'omics data in Basel, Switzerland, 19-21st November]]></title>
  <description><![CDATA[
<p>Benefits for the participants</p>

<p>- Plan more efficient experiments<br />- Correctly interpret results<br />- Communicate results in publications more effectively</p>

<p>The course focus is on methodologies, not on particular software tools. After the course participants should be able to apply the methods in their respective environment. However, during the course, hands-on sessions will be performed using the Genedata Expressionist® software, which enables participants to quickly apply the discussed methods and visualize results. No previous knowledge on Expressionist® is required; access to the software is free of charge during the course.</p>

<p>More @ http://www.dixa-fp7.eu/dixa-training/dixa-training-agenda/genedata-academy#!</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5209/anders-krogh-lab</guid>
  <pubDate>Mon, 30 Sep 2013 19:07:40 -0500</pubDate>
  <link></link>
  <title><![CDATA[Anders Krogh Lab]]></title>
  <description><![CDATA[
<p>In a lot of my work in bioinformatics, I have been using hidden Markov models (HMMs). As a postdoc with David Haussler at UCSC we developed the so-called profile HMMs (refs). Since then I have applied HMMs to membrane proteins (refs) and gene identification (refs) and have worked on methods for such things as discriminative estimation of HMMs (refs) and alternative decoding algorithms etc. (refs).</p>

<p>Now my main interests are in gene regulation, where we work on promoter analysis; non-coding RNA, where miRNAs and structure prediction are the main areas; and protein structure, where the group is working on methods for structure prediction from sequence. To read more about these topics, please see the research pages. </p>

<p>Lab page @ http://wiki.binf.ku.dk/User:Krogh</p>
]]></description>
</item>

</channel>
</rss>