SCHOOL OF COMPUTATIONAL AND INTEGRATIVE SCIENCES (SC&IS)

ESSENTIAL QUALIFICATION : - M.Sc./M.Tech. in Physics/ Chemistry/ Biology/ Mathematics/ Statistics/ Bioinformatics/ Computational Biology. Ph.D. in the broad areas of Bioinformatics/ Computational Biology. Candidates must have demonstrated capabilities in terms of high impact research publications in either of the above mentioned areas.

Scale of Pay : - 15600-39100/- (PB-III) AGP Rs. 6000/-

For more details on Centre/School, Specializations etc. please visit JNU website www.jnu.ac.in or contact Section Officer, Room Nos. 131-132, Recruitment Cell, Administrative Block, JNU, New Delhi – 110067, Email: recruitmentjnu2013@gmail.com The last date for the receipt of application is 15 May, 2014.

http://www.jnu.ac.in/Career/

http://www.jnu.ac.in/Career/ADVTNo_RC_48_2014.pdf
Last Apply Date:

15 May 2014

Check out the changes they made.

They added the cleanup-blastdb-volumes.py script to remove unused BLAST database volumes. Read the documentation here.

They also switched the protocol from ftp to https to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the update_blastdb.pl script.

And fixed a few bugs related to downloading data from the NCBI, and mt_mode crashing blastn and blastx.

Check out the release notes.

Download BLAST+ 2.14.1

Questions or comments? Please write the BLAST help desk.

More info and download: https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

WALK- IN –INTERVIEWS

Eligible candidates may appear in Walk-in-Interview on May 23, 2014 at 10 AM for the posts of Research Associates & Senior Research Fellows (SRF) in the following DST/DBT/ICAR funded projects.

1 NPTC Project on Bioinformatics and Comparative Genomics

Research Associate (One)

Rs. 24000/- + 30% HRA for masters degree holder with more than 4 years experience

Essential: Ph D in Plant Molecular Biology & Biotechnology/Genetics 0r Candidates who have already submitted their Ph D thesis in above subjects

Desirable: Research experience in Genomics, Molecular biology, Microarrays analysis, Gene cloning, transgenic Techniques , and computational analysis.

Senior Research Fellow ( UGCCSIR/ DBT/ ICAR Net qualified only): (One)

Rs. 16000/- + 30% HRA and Rs. 18000+30 HRA from 3rd year onwards

Essential:

1. ICAR/ UGCCSIR/DBT Net qualified only

2. M. Sc. (with thesis) in Biotechnology, Life Sciences, Biosciences/ Bioinformatics, Genetics/ Plant Pathology with experience in molecular biology.

Or M.Sc with more than 3 years research experiences

3. B.Sc. Agriculture or Biology

Desirable:
1. M. Sc. with thesis
2. Experience in molecular biology, plant tissue culture
3. Bioinformatics knowledge is important

2 DST JC Bose National Fellowship

Research Associate (Bioinformatics) : One

Rs.22000/- + 30% HRA for 1 & 2nd Yr., Rs. 23000+ 30% HRA for 3rd year and Rs. 24000+30% HRA for 4th &5th yr

Essential: M Ph D in Plant Molecular Biology & Biotechnology/Genetics

Desirable: Research experience in Genomics, Molecular biology, Microarrays analysis, Gene cloning, transgenic Techniques , and computational analysis.

Age limit: Max.35 years (Age relaxation of 5 years for SC/ST & women and 3 years for OBC)

The posts are purely temporary in nature and are co-terminus with the project. Initially the offer will be made for one year only and may be further extendable based on performance of the candidate. The interview will be held on May 23 , 2014 at 10:00 AM at NRCPB, LBS Building, Pusa Campus, IARI, New Delhi- 110012. The candidates must bring four copies of biodata (in the prescribed proforma), original certificates, attested photocopies of each of the certificates and an attested copy of recent passport size photograph. No. TA/DA would be given for the appearance in interview. Only the candidates having essential qualification would be entertained for the interviews. Short-listing of candidates based on academic merit and experience will be done in case of large number of applicants.

Advertisement: http://www.nrcpb.org/sites/default/files/Advertisement%20for%20RA%20and%20SRF%20Position.pdf

2.Mapmygenome™
Royal Demeure,HUDA Techno Enclave,
Plot No. 12/2, Sector-1 500 081 
Madhapur,Hyderabad
AP, India

3. DNA Labs India

http://www.dnalabsindia.com/lab.php

4.MedGenome Labs Pvt Ltd
(Division of SciGenom Labs Pvt Ltd.)
Plot no: 43A,SDF, 3rd floor
A Block,CSEZ, Kakanad, Cochin
Kerala - 682037 
Phone: 0484 - 2413399
Fax: 0484 - 2413398
Email: info@medgenome.com

5.Narayana Nethralaya

Narayana Hrudayalaya Campus
Narayana Health City
# 258/A, Bommasandra, Hosur Road, 
Bangalore - 560 099 - INDIA.
TEL: +91-80-66660655-0658 
FAX: +91-80-66660650 
Mobile: 9902 821128 (Emergency Only)
e-mail: info@narayananethralaya.com

6.BioAxis DNA Research Centre Private Limited
13-51,Sri Lakshmi Nagar colony,
Besides Big Bazar, Near Kamineni Hospitals
GSI Post BandalGuda (L B Nagar) Hydeabad-500068
Andhra Pradesh (India).
Phone : +91-40-24034503/+91-9246338983

7.Gene Guiide

8th Floor, Embassy Towers, 7 Bungalows Rd, Versova, Andheri West, Mumbai-61 
 09167 117799 
 info@geneguiide.com 

See more at: http://www.geneguiide.com

8.INDIAN BIOSCIENCES
Regd. Office:
G-2 (Ground Floor Rear), Kailash Colony, New Delhi - 110048, India.
Phone: +91 (0)11 29236088, Email: info@inbdna.com.

9.SRL Limited

GP-26, MARUTI INDUSTRIAL ESTATE,

UDYOG VIHAR,SECTOR-18,

GURGAON - 122015

Tel: 0124-3001243 / 0124-3001209

SRL Limited
VASANT VIHAR, 8, PALAM MARG,
NEW DELHI - 110057
Tel: 011 - 4229 5333 

Website: http://www.srlworld.com
National Customer care number:
Call Toll Free : 1800-222-660/1800-102-8282 
E-mail id: customercare@srl.in

10.Tata Memorial Centre,

Advanced Centre for Treatment, Research and Education in Cancer

Kharghar, Navi Mumbai - 410 210, INDIA.

Tel: +91-22-2740 5000

Fax: +91-22-2740 5085

E-mail: mail@actrec.gov.in

C. Titus Brown http://video.open-bio.org/video/1/a-history-of-bioinformatics-in-the-year-2039

Ever since a monk called Mendel started breeding pea plants we've been learning about our genomes. In 1953, Watson, Crick and Franklin described the structure of the molecule that makes up our genomes: the DNA double helix. Then, in 2001, scientists wrote down the entire 3-billion letter code contained in the average human genome. Now they're trying to interpret that code; to work out how it's used to make different types of cells and different people. The ENCODE project, as it's called, is the latest chapter in the story of you. To read the ENCODE research papers and more, visit http://www.nature.com/ENCODE