<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32376?offset=970</link>
	<atom:link href="https://bioinformaticsonline.com/related/32376?offset=970" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/10749/memories-can-be-passed-down-through-dna</guid>
	<pubDate>Sat, 10 May 2014 21:24:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/10749/memories-can-be-passed-down-through-dna</link>
	<title><![CDATA[Memories Can Be Passed Down Through DNA]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/tbPwzII_g6o" frameborder="0" allowfullscreen></iframe>The premise of Assassin's Creed is the reliving of other people's memories stored inside DNA. Well scientists have found that in mice, it actually happens! Anthony is joined by special guest and our friend Tara Long from Hard Science to explain how this process works, and if it might apply to humans as well.

Read More: 
Parental olfactory experience influences behavior and neural structure in subsequent generations
http://www.nature.com/neuro/journal/vaop/ncurrent/abs/nn.3594.html
"Using olfactory molecular specificity, we examined the inheritance of parental traumatic exposure, a phenomenon that has been frequently observed, but not understood."

What Is Epigenetics?
http://www.sciencemag.org/content/330/6004/611
"The cells in a multicellular organism have nominally identical DNA sequences (and therefore the same genetic instruction sets), yet maintain different terminal phenotypes. This nongenetic cellular memory, which records developmental and environmental cues (and alternative cell states in unicellular organisms), is the basis of epi-(above)-genetics."

Epigenetics
http://en.wikipedia.org/wiki/Epigenetics

Watch More:
How to Change Your Genes
https://www.youtube.com/watch?v=B5DU9lgbsSE
TestTube Wild Card
http://testtube.com/dnews/dnews-231-how-too-many-screens-affect-our-brain?utm_source=YT&utm_medium=DNews&utm_campaign=DNWC
Is Sexiness Hereditary?
https://www.youtube.com/watch?v=z6STRCncvM8
____________________

DNews is dedicated to satisfying your curiosity and to bringing you mind-bending stories & perspectives you won't find anywhere else! New videos twice daily. 

Watch More DNews on TestTube http://testtube.com/dnews

Subscribe now! http://www.youtube.com/subscription_center?add_user=dnewschannel

DNews on Twitter http://twitter.com/dnews

Anthony Carboni on Twitter http://twitter.com/acarboni

Laci Green on Twitter http://twitter.com/gogreen18

Trace Dominguez on Twitter http://twitter.com/trace501

DNews on Facebook http://facebook.com/dnews

DNews on Google+ http://gplus.to/dnews

Discovery News http://discoverynews.com]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10773/bioinformatics-jrfsrf-position-at-national-research-centre-on-plant-biotechnology</guid>
  <pubDate>Sun, 11 May 2014 22:29:12 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics JRF/SRF position at NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY]]></title>
  <description><![CDATA[
<p>NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY<br />LBS, CENTRE, PUSA CAMPUS, IARI NEW DELHI<br />NEW DELHI – 110 012</p>

<p>WALK- IN –INTERVIEWS</p>

<p>Eligible candidates may appear in Walk-in-Interview on May 23, 2014 at 10 AM for the posts of Research Associates &amp; Senior Research Fellows (SRF) in the following DST/DBT/ICAR funded projects.</p>

<p>1 NPTC Project on Bioinformatics and Comparative Genomics</p>

<p>Research Associate (One)</p>

<p>Rs. 24000/- + 30% HRA for masters degree holder with more than 4 years experience</p>

<p>Essential: Ph D in Plant Molecular Biology &amp; Biotechnology/Genetics 0r Candidates who have already submitted their Ph D thesis in above subjects</p>

<p>Desirable: Research experience in Genomics, Molecular biology, Microarrays analysis, Gene cloning, transgenic Techniques , and computational analysis.</p>

<p>Senior Research Fellow ( UGCCSIR/ DBT/ ICAR Net qualified only): (One)</p>

<p>Rs. 16000/- + 30% HRA and Rs. 18000+30 HRA from 3rd year onwards</p>

<p>Essential:</p>

<p>1. ICAR/ UGCCSIR/DBT Net qualified only</p>

<p>2. M. Sc. (with thesis) in Biotechnology, Life Sciences, Biosciences/ Bioinformatics, Genetics/ Plant Pathology with experience in molecular biology.</p>

<p>Or M.Sc with more than 3 years research experiences</p>

<p>3. B.Sc. Agriculture or Biology</p>

<p>Desirable:<br />1. M. Sc. with thesis<br />2. Experience in molecular biology, plant tissue culture<br />3. Bioinformatics knowledge is important</p>

<p>2 DST JC Bose National Fellowship</p>

<p>Research Associate (Bioinformatics) : One</p>

<p>Rs.22000/- + 30% HRA for 1 &amp; 2nd Yr., Rs. 23000+ 30% HRA for 3rd year and Rs. 24000+30% HRA for 4th &amp;5th yr</p>

<p>Essential: M Ph D in Plant Molecular Biology &amp; Biotechnology/Genetics</p>

<p>Desirable: Research experience in Genomics, Molecular biology, Microarrays analysis, Gene cloning, transgenic Techniques , and computational analysis.</p>

<p>Age limit: Max.35 years (Age relaxation of 5 years for SC/ST &amp; women and 3 years for OBC)</p>

<p>The posts are purely temporary in nature and are co-terminus with the project. Initially the offer will be made for one year only and may be further extendable based on performance of the candidate. The interview will be held on May 23 , 2014 at 10:00 AM at NRCPB, LBS Building, Pusa Campus, IARI, New Delhi- 110012. The candidates must bring four copies of biodata (in the prescribed proforma), original certificates, attested photocopies of each of the certificates and an attested copy of recent passport size photograph. No. TA/DA would be given for the appearance in interview. Only the candidates having essential qualification would be entertained for the interviews. Short-listing of candidates based on academic merit and experience will be done in case of large number of applicants.</p>

<p>Advertisement: http://www.nrcpb.org/sites/default/files/Advertisement%20for%20RA%20and%20SRF%20Position.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/1897/genetic-test-in-india</guid>
	<pubDate>Sun, 11 Aug 2013 10:54:35 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/1897/genetic-test-in-india</link>
	<title><![CDATA[Genetic Test in India]]></title>
	<description><![CDATA[<p>1.<strong>Xcode Life Sciences Pvt. Ltd.</strong><br /><span>6B, Eldorado,&nbsp;</span><br /><span>112, Nungambakkam High Road,</span><br /><span>Nungambakkam, Chennai 600034</span><br /><span>Tamil Nadu, India&nbsp;</span></p><p>2.<span><strong>Mapmygenome&trade;</strong><br /></span><span>Royal Demeure,HUDA Techno Enclave,<br />Plot No. 12/2, Sector-1 500 081&nbsp;<br />Madhapur,Hyderabad<br />AP, India</span></p><p>3.<strong>&nbsp;DNA Labs India</strong></p><p><strong><a href="http://www.dnalabsindia.com/lab.php">http://www.dnalabsindia.com/lab.php</a></strong></p><p>&nbsp;</p><p>4.<strong>MedGenome Labs Pvt Ltd</strong><br /><span>(Division of SciGenom Labs Pvt Ltd.)</span><br /><span>Plot no: 43A,SDF, 3rd floor</span><br /><span>A Block,CSEZ, Kakanad, Cochin</span><br /><span>Kerala - 682037&nbsp;</span><br /><span>Phone: 0484 - 2413399</span><br /><span>Fax: 0484 - 2413398</span><br /><span>Email:&nbsp;</span><a href="mailto:info@medgenome.com">info@medgenome.com</a></p><p>5.<strong>Narayana Nethralaya</strong></p><p><span>Narayana Hrudayalaya Campus</span><br /><span>Narayana Health City</span><br /><span># 258/A, Bommasandra, Hosur Road,&nbsp;</span><br /><span>Bangalore - 560 099 - INDIA.</span><br /><span>TEL: +91-80-66660655-0658&nbsp;</span><br /><span>FAX: +91-80-66660650&nbsp;</span><br /><span>Mobile: 9902 821128 (Emergency Only)</span><br /><span>e-mail:&nbsp;</span><a href="mailto:info@narayananethralaya.com">info@narayananethralaya.com</a></p><p>6.<strong>BioAxis DNA Research Centre Private Limited</strong><br />13-51,Sri Lakshmi Nagar colony,<br />Besides Big Bazar, Near Kamineni Hospitals<br />GSI Post BandalGuda (L B Nagar) Hydeabad-500068<br />Andhra Pradesh (<strong>India</strong>).<br />Phone :&nbsp;+91-40-24034503/+91-9246338983</p><p>7.<strong>Gene Guiide</strong></p><p>8th Floor, Embassy Towers, 7 Bungalows Rd, Versova, Andheri West, Mumbai-61&nbsp;<br />&nbsp;09167 117799&nbsp;<br />&nbsp;<a href="mailto:info@geneguiide.com" target="_blank">info@geneguiide.com</a>&nbsp;</p><p>See more at: http://www.geneguiide.com</p><p>8.<strong>INDIAN BIOSCIENCES</strong><br />Regd. Office:<br />G-2 (Ground Floor Rear), Kailash Colony, New Delhi - 110048, India.<br />Phone: +91 (0)11 29236088, Email: info@inbdna.com.</p><p>9.<strong>SRL Limited</strong></p><p>GP-26, MARUTI INDUSTRIAL ESTATE,</p><p>UDYOG VIHAR,SECTOR-18,</p><p>GURGAON - 122015</p><p>Tel: 0124-3001243 / 0124-3001209</p><p><strong>SRL Limited</strong><br />VASANT VIHAR, 8, PALAM MARG,<br />NEW DELHI - 110057<br />Tel: 011 - 4229 5333&nbsp;</p><p><strong>Website:</strong>&nbsp;<a href="http://www.srlworld.com/" target="_blank">http://www.srlworld.com</a><br /><strong>National Customer care number:</strong><br />Call Toll Free : 1800-222-660/1800-102-8282&nbsp;<br /><strong>E-mail id:</strong>&nbsp;<a href="mailto:customercare@srl.in">customercare@srl.in</a></p><p>10.<strong>Tata Memorial Centre</strong>,</p><p>Advanced Centre for Treatment, Research and Education in Cancer</p><p>Kharghar, Navi Mumbai - 410 210, INDIA.</p><p>Tel: +91-22-2740 5000</p><p>Fax: +91-22-2740 5085</p><p>E-mail: mail@actrec.gov.in</p><p style="text-align: center;">&nbsp;</p><p style="text-align: center;"><span style="font-size: large;"><a href="mailto:office@actrec.gov.in"></a></span></p><p>&nbsp;</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/12943/a-history-of-bioinformatics-in-the-year-2039</guid>
	<pubDate>Wed, 23 Jul 2014 06:37:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/12943/a-history-of-bioinformatics-in-the-year-2039</link>
	<title><![CDATA[A History of Bioinformatics (in the Year 2039)]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/uwsjwMO-TEA" frameborder="0" allowfullscreen></iframe><p>C. Titus Brown http://video.open-bio.org/video/1/a-history-of-bioinformatics-in-the-year-2039</p>]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/3917/the-story-of-you-encode-and-the-human-genome</guid>
	<pubDate>Sat, 24 Aug 2013 18:49:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/3917/the-story-of-you-encode-and-the-human-genome</link>
	<title><![CDATA[The Story of You: ENCODE and the human genome]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/TwXXgEz9o4w" frameborder="0" allowfullscreen></iframe><p>Ever since a monk called Mendel started breeding pea plants we've been learning about our genomes. In 1953, Watson, Crick and Franklin described the structure of the molecule that makes up our genomes: the DNA double helix. Then, in 2001, scientists wrote down the entire 3-billion letter code contained in the average human genome. Now they're trying to interpret that code; to work out how it's used to make different types of cells and different people. The ENCODE project, as it's called, is the latest chapter in the story of you. To read the ENCODE research papers and more, visit http://www.nature.com/ENCODE</p>]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4761/dna-is-packaged-in-a-chromosome-experiment</guid>
	<pubDate>Mon, 23 Sep 2013 18:01:12 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4761/dna-is-packaged-in-a-chromosome-experiment</link>
	<title><![CDATA[DNA is packaged in a chromosome experiment]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/fecfROFrp_c" frameborder="0" allowfullscreen></iframe>For more information, log on to-
http://shomusbiology.weebly.com/
Download the study materials here-
http://shomusbiology.weebly.com/bio-materials.html
A nucleosome is the basic unit of DNA packaging in eukaryotes, consisting of a segment of DNA wound in sequence around four histone protein cores.[1] This structure is often compared to thread wrapped around a spool.[2]

Nucleosomes form the fundamental repeating units of eukaryotic chromatin,[3] which is used to pack the large eukaryotic genomes into the nucleus while still ensuring appropriate access to it (in mammalian cells approximately 2 m of linear DNA have to be packed into a nucleus of roughly 10 µm diameter). Nucleosomes are folded through a series of successively higher order structures to eventually form a chromosome; this both compacts DNA and creates an added layer of regulatory control, which ensures correct gene expression. Nucleosomes are thought to carry epigenetically inherited information in the form of covalent modifications of their core histones. Nucleosomes were observed as particles in the electron microscope by Don and Ada Olins [4] and their existence and structure (as histone octamers surrounded by approximately 200 base pairs of DNA) were proposed by Roger Kornberg.[5][6] The role of the nucleosome as a general gene repressor was demonstrated by Lorch et al. in vitro [7] and by Han and Grunstein in vivo.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</guid>
	<pubDate>Fri, 30 May 2014 13:24:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</link>
	<title><![CDATA[How to sequence the human genome - Mark J. Kiel]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/MvuYATh7Y74" frameborder="0" allowfullscreen></iframe>View full lesson: http://ed.ted.com/lessons/how-to-sequence-the-human-genome-mark-j-kiel

Your genome, every human's genome, consists of a unique DNA sequence of A's, T's, C's and G's that tell your cells how to operate. Thanks to technological advances, scientists are now able to know the sequence of letters that makes up an individual genome relatively quickly and inexpensively. Mark J. Kiel takes an in-depth look at the science behind the sequence.

Lesson by Mark J. Kiel, animation by Marc Christoforidis.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5761/how-i-discovered-dna-james-watson</guid>
	<pubDate>Fri, 18 Oct 2013 11:30:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5761/how-i-discovered-dna-james-watson</link>
	<title><![CDATA[How I discovered DNA - James Watson]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/RvdxGDJogtA" frameborder="0" allowfullscreen></iframe><p>View full lesson: http://ed.ted.com/lessons/james-watson-on-how-he-discovered-dna Nobel laureate James Watson opens TED2005 with the frank and funny story of how he and his research partner, Francis Crick, discovered the structure of DNA. Talk by James Watson.</p>]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11354/genomics-and-personalized-medicine</guid>
	<pubDate>Sun, 01 Jun 2014 23:38:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11354/genomics-and-personalized-medicine</link>
	<title><![CDATA[Genomics and Personalized Medicine]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/pgHAXCMMcro" frameborder="0" allowfullscreen></iframe>(October 20, 2009) Michael Snyder, Professor of Genetics and Chair of the Department of Genetics at Stanford, discusses advances in gene sequencing, the impact of genomics on medicine, the potential for personalized medicine. and efforts at Stanford to further study these issues.

Stanford Mini Med School is a series arranged and directed by Stanford's School of Medicine, and presented by the Stanford Continuing Studies program. Featuring more than thirty distinguished, faculty, scientists and physicians from Stanford's medical school, the series offers students a dynamic introduction to the world of human biology, health and disease, and the groundbreaking changes taking place in medical research and health care.

Stanford University
http://www.stanford.edu

Stanford University School of Medicine
http://med.stanford.edu

Stanford Continuing Studies
http://continuingstudies.stanford.edu

Stanford University Channel on YouTube:
http://www.youtube.com/stanford]]></description>
	
</item>

</channel>
</rss>