To read the manual, please click the link https://askarbek-orakov.github.io/ASAR/

Address of the bookmark: https://github.com/Askarbek-orakov/ASAR

Address of the bookmark: https://github.com/yjx1217/LRSDAY

Workshops are conducted in regular intervals on Drug Designing, Protein Modeling and Simulation, Chemoinformatics, Bioinformatics etc.The workshops are highly beneficial for working professionals, students, researcher for enhancements of the skills in short duration.

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

More at http://homes.sice.indiana.edu/yye/lab/teaching/spring2017-I529/

More tutorial at 

http://calla.rnet.missouri.edu/cheng_courses/mlbioinfo/mlbioinfo.htm

http://www.raetschlab.org/lectures/MLBioinformatics

http://www.raetschlab.org/lectures/bertinoro08

Book at 

https://personal.utdallas.edu/~pradiptaray/teaching/7_deep_learning_bioinfo.pdf

Address of the bookmark: http://homes.sice.indiana.edu/yye/lab/teaching/spring2017-I529/

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

Bioinformatician replied:

if ($date == "Valentine's Day" && $me =! Bioinformatician) {

rose_day(); promise_day(); kiss_day();

}

else {

hack_genome(); ko-fi(); youtube(); do_scripting(); sleep();

)

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

DBT-Junior Research Fellowship (DBT-JRF) in Biotechnology (2020)

BIOTECHNOLOGY ELIGIBILITY TEST (BET) 2020

Applications are invited from bonafide Indian citizens, residing in India for award of “DBT-Junior Research Fellowship” (DBT-JRF) for pursuing research in frontier areas of Biotechnology and Life Sciences. The candidates will be selected through “Biotechnology Eligibility Test (BET)”. Based on the performance in BET, two categories of merit list will be prepared (Category-I and Category-II). Government of India norms for reservation will be followed for selection. Candidates selected under category-I will be eligible to avail fellowship under the programme. These will be tenable at any University/Institute in India where the selected candidate registers for PhD Programme. Candidates selected under Category-II will be eligible to be appointed in any DBT sponsored project and avail fellowship from the project equivalent to NET/GATE, subject to selection through institutional selection process. There will be no binding on Principal Investigators of DBT sponsored projects to select JRF for their project from category-II list. Selection in category-II will not entitle student for any fellowship from DBT-JRF programme.

ELIGIBILITY

Qualification: M.Sc./ M.Tech./ M.V.Sc. or equivalent degree/ Integrated BS-MS/ B.E./ B.Tech. in any discipline of Biotechnology, M.Sc./ M.Tech. Bioinformatics/ Computational Biology, students admitted under DBT supported Postgraduate Teaching Programs. M.Sc. Life Science/ Bioscience/ Zoology/ Botany/ Microbiology/ Biochemistry/ Biophysics and Masters in Allied areas of Biology/Life Sciences. Candidates appearing in the final year examination are also eligible to apply.

Marks: Minimum 60% marks for General, EWS & OBC category and 55% for SC/ ST/ Differently abled in aggregate (or equivalent grade).

Age Limit: Upto 28 years as on the last date of application for General & EWS category. Age relaxation of up to 5 years (33 years) for SC/ ST/ Differently Abled/ women candidates and upto 3 years (31 years) for OBC (Non-Creamy Layer) candidates.

For detailed procedure for filling the application form, payment of application fee and uploading of required documents/ certificates in the prescribed format, please visit: http://rcb.res.in/BET2020. A non-refundable and non-transferable application fee of Rs. 1000/-is payable online by General/ OBC/ EWS candidates and Rs 250/- by SC/ ST/ Differently abled candidates.

IMPORTANT DATES