<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32465?offset=330</link>
	<atom:link href="https://bioinformaticsonline.com/related/32465?offset=330" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22891/17-marie-curie-phd-position-available-immediately</guid>
  <pubDate>Tue, 23 Jun 2015 06:52:06 -0500</pubDate>
  <link></link>
  <title><![CDATA[17 Marie Curie PhD position available immediately]]></title>
  <description><![CDATA[
<p>Kindly look into following webpage:<br />http://medhealth.leeds.ac.uk/info/1450/scholarships/1795/marie_curie_phd_training_network</p>

<p>The closing date for application will be 26 June 2015.</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4551/au-kbc-lab</guid>
  <pubDate>Sun, 15 Sep 2013 09:33:59 -0500</pubDate>
  <link></link>
  <title><![CDATA[AU-KBC Lab]]></title>
  <description><![CDATA[
<p>Conducting Clinical Trial Management Course combined with the Apollo Hospitals. Major Research in bioinformatics as Drug Discovery, Functional Genomics, Comparative genomics, Data Mining </p>

<p>More @ http://www.au-kbc.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6458/bigre-lab</guid>
  <pubDate>Sun, 17 Nov 2013 10:35:49 -0600</pubDate>
  <link></link>
  <title><![CDATA[BIGRE Lab]]></title>
  <description><![CDATA[
<p>The Laboratoire de Bioinformatique des Génomes et des Réseaux (Genome and Network Bioinformatics) is specialized in the conception, implementation, evaluation and application of bioinformatics approaches for the analysis of genome, transcriptome, proteome and metabolism.<br />Our main activities include</p>

<p>Analysis of regulatory sequences (RSAT project)<br />Classification and analysis of mobile genetic elements (ACLAME project).<br />Analysis of molecular interaction networks (NeAT project)<br />Inference of metabolic pathways from genomic and post-genomic data <br />(metabolic pathfinding, see also metabolic pathfinding in NeAT)<br />Critical assesment of protein interactions (CAPRI)</p>

<p>Lab Page http://www.bigre.ulb.ac.be/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/2349/bioinformatics-understanding-of-living-systems-through-information-science</guid>
	<pubDate>Wed, 14 Aug 2013 11:50:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/2349/bioinformatics-understanding-of-living-systems-through-information-science</link>
	<title><![CDATA[Bioinformatics -- Understanding of living systems through  information science]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/6Ovd_GOM9-g" frameborder="0" allowfullscreen></iframe>Recently, the progress of the Human Genome Project, aiming to decode all human DNA sequences, has highlighted a research field called bioinformatics. In this new field, computers and techniques from information science are not just used as tools to advance life science research; they're expected to have a major impact on how we think about the life sciences.

Q. The main feature of bioinformatics is, it utilizes computers to analyze life. One is example is the genome. In all organisms, DNA contains genetic information, and this is called the genome. But the amount of information involved is huge, so recently, it's been read using next-generation sequencers, and analyzed by computers. In bioinformatics research, what we do is utilize those genome information to investigate the principles of life.

As an organism evolves, its genome sequence changes through sudden mutations. Additionally, at the genome level, mutations called rearrangements, such as inversions, transpositions, and duplications, occur. 

The genome comparison system developed by the Sakakibara Lab calculates homologous sequences called anchors, which are conserved between species. If the genome is considered as a long text, then anchors can be thought of as words.

Q. We're coming to understand the genomes of various organisms - not just humans, but monkeys, chimpanzees, bacteria, and so on. The first method used to analyze a genome is comparing it with the genomes of other organisms, to see where it's the same and where it's different. In that way, the content of the genome is decoded bit by bit, using computers. By contrast, in our method, we've developed software called Murasaki, which we also use to analyze large genomes, by comparing them with those of other organisms.

The Sakakibara Lab uses a next-generation sequencer at Keio University, along with a cluster machine with hundreds of CPUs. In this way, the Lab is analyzing genome mutations that cause cancer, and the genome of the natto production strain Bacillus subtilis.

Until now, genome analysis could only be done in national-scale projects. But now, next-generation sequencer development has made genome analysis possible in an ordinary lab. In a world-first achievement, the Sakakibara Lab has decoded the natto bacillus genome, through analysis using Keio's next-generation sequencer.

Q. In the future, biology and the life sciences may become almost entirely information science and computer science. And in healthcare, that may enable us, for example, to predict whether individuals are susceptible to cancer, or to certain lifestyle-related diseases, by understanding their personal genome data. So, I think it's amply possible that we can make use of such information effectively, to help people live longer and be free from disease, by thinking about their lifestyle habits.
 
Bioinformatics is only two decades old. In this field, many areas are still unknown. Professor Sakakibara, having been involved since the beginning, will continue tackling new, challenging research projects.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36483/popular-bioinformatics-educational-resources</guid>
	<pubDate>Fri, 04 May 2018 19:43:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36483/popular-bioinformatics-educational-resources</link>
	<title><![CDATA[Popular bioinformatics educational resources !]]></title>
	<description><![CDATA[<p>Followings are the list of popular bioinformatics educational resources</p><p><a href="http://Bii.a-star.edu.sg"><strong>Bii.a-star.edu.sg</strong></a></p><p>Bio research and development. Has course information and research information.</p><p><a href="http://Isb-sib.ch"><strong>Isb-sib.ch</strong></a></p><p>SIB operates the ExPASy proteomics server and the Swiss node of EMBnet. Teaching activities include a series of post-graduate courses given at the Universities of Geneva and Lausanne, as well as at the EPFL, and a Masters Degree in bioinformatics. Major research areas include the development of integrated databases and software resources in the field of proteomics.</p><p><a href="http://Bioinformatics.ca"><strong>Bioinformatics.ca</strong></a></p><p>Provides information about bioinformatics in Canada. Workshops, certification and resources.</p><p><a href="http://Chickscope.beckman.uiuc.edu"><strong>Chickscope.beckman.uiuc.edu</strong></a></p><p>Students raise chicken embryos in the classroom and obtain magnetic resonance images through the Internet.</p><p><a href="http://Bcb.iastate.edu"><strong>Bcb.iastate.edu</strong></a></p><p>Graduate program at Iowa State University offering Undergraduate Major (BCBio) and the PhD program (BCB).</p><p><a href="http://Bu.edu/bioinformatics/"><strong>Bu.edu/bioinformatics/</strong></a></p><p>Interdisciplinary PhD and Masters Programs that include an internship in the local industry companies. In conjunction with the NE masters program.</p><p><a href="http://Bioinformatics.ubc.ca"><strong>Bioinformatics.ubc.ca</strong></a></p><p>A computational biology research centre covering many areas of genomics, proteomics, computer science and statistics. Research, training, news and events, resources and support, director's message, faculty and personnel.</p><p><a href="http://Openhelix.com"><strong>Openhelix.com</strong></a></p><p>Provides onsite training on specific bioinformatics databases and tools. Also offers bioinformatic software testing and research consulting services.</p><p><a href="http://Igb.uci.edu"><strong>Igb.uci.edu</strong></a></p><p>Specializing in making publicly available software and database services for computational biology.</p><p><a href="http://Bioinformatics.pe.kr"><strong>Bioinformatics.pe.kr</strong></a></p><p>Maintained by Dr. Seyeon Weon, Korea providing information on courses, a database archive, software archive and online resources.</p><p><a href="http://Groups.yahoo.com/group/bimatics/"><strong>Groups.yahoo.com/group/bimatics/</strong></a></p><p>Bioinformatics group for students interested and/or working in the bioinformatics/computationalbiology fields. Offers opportunities to exchanging information and sharing ideas.</p><p><a href="http://Ncbi.nlm.nih.gov/books/NBK22183/"><strong>Ncbi.nlm.nih.gov/books/NBK22183/</strong></a></p><p>Information about several medically important genes and related diseases. Illustrates the use of bioinformatics in their study.</p><p><a href="http://Bioinfo.mbb.yale.edu/mbb452a/2003/"><strong>Bioinfo.mbb.yale.edu/mbb452a/2003/</strong></a></p><p>Bioinformatics course at Yale University. All course slides are available online.</p><p><a href="http://Cs.iastate.edu/~honavar/comp-bio-courses.html"><strong>Cs.iastate.edu/~honavar/comp-bio-courses.html</strong></a></p><p>Listing of computational molecular biology course pages that have extensive online course materials.</p><p><a href="http://Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html"><strong>Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html</strong></a></p><p>A web-based tutorial associated with "Introduction to bioinformatics" published by Addison Wesley Longman.</p><p><a href="http://Northeastern.edu/bioinformatics/"><strong>Northeastern.edu/bioinformatics/</strong></a></p><p>From the Biology department and in cooperation with Boston University. Emphasis on the ability to integrate knowledge from biological, computational, and mathematical disciplines.</p><p><a href="http://Biocomp.unibo.it/lsbioinfo/"><strong>Biocomp.unibo.it/lsbioinfo/</strong></a></p><p>A two year, international master's programme in bioinformatics at the Universita di Bologna, Italy.</p><p><a href="http://Cs.helsinki.fi/bioinformatiikka/mbi/programme.html"><strong>Cs.helsinki.fi/bioinformatiikka/mbi/programme.html</strong></a></p><p>A two year Masters Degree Programme in Bioinformatics (MBI) offered by the University of Helsinki and Helsinki University of Technology, Finland.</p><p><a href="http://Ornl.gov/sci/techresources/Human_Genome/education/education.shtml"><strong>Ornl.gov/sci/techresources/Human_Genome/education/education.shtml</strong></a></p><p>A resource for introductory information on the Human Genome Project.</p><p><a href="http://His.se/bioinformatics"><strong>His.se/bioinformatics</strong></a></p><p>A one-year, international master's programme in bioinformatics at the University of Skovde, Sweden.</p><p><a href="http://Members.tripod.com/C.elegans/"><strong>Members.tripod.com/C.elegans/</strong></a></p><p>Resources in biochemical, molecular, cellular, system, and organism biology, including over 25,000 indexed links, accumulated since 2000, from topic menus or from search interface.</p><p><a href="http://Bioinformatics.org/faq/#contents"><strong>Bioinformatics.org/faq/#contents</strong></a></p><p>Summary of basics of bioinformatics for the intelligent newcomer.</p><p><a href="http://Jiscmail.ac.uk/archives/bioinformatics.html"><strong>Jiscmail.ac.uk/archives/bioinformatics.html</strong></a></p><p>Forum featuring various aspects, events and developments in the bioinformatics field.</p><p><a href="http://Biinoida.blogspot.com"><strong>Biinoida.blogspot.com</strong></a></p><p>Blog focusing on bioinformatics, biotechnology, pharma regulatory affairs, IPR and clinical trials.</p><p><a href="http://Colorbasepair.com/bioinformatics_courses_tutorials.html"><strong>Colorbasepair.com/bioinformatics_courses_tutorials.html</strong></a></p><p>A list of on-line course materials and tutorials for bioinformatics and computational biology.</p><p><a href="http://Geospiza.com/education/"><strong>Geospiza.com/education/</strong></a></p><p>Instructional materials for teaching bioinformatics. These include animated tutorials on topicssuch as BLAST, finding mutations in a protein, and graphing with MS-Excel.</p><p><a href="http://Bioinformatics.fi"><strong>Bioinformatics.fi</strong></a></p><p>An international, two-year Master's programme jointly managed by the University of Tampere and the University of Turku, Finland.</p><p><a href="http://Perlsource.net"><strong>Perlsource.net</strong></a></p><p>Provides online courses in Perl programming for bioinformatic tools.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4547/bioinformatics-infrastructure-facility</guid>
  <pubDate>Sun, 15 Sep 2013 09:22:25 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Infrastructure Facility]]></title>
  <description><![CDATA[
<p>The Bioinformatics Infrastructure Facility has started working in the year 2007 at Presidency College, Kolkata. It is one of the premier institutes of India and boasts of a rich heritage and great alumni. The Infrastructure Facility has a dedicated team headed by Sayak Ganguli and ably supported by Priayanka Dhar. The coordinator of the facility is Abhijit Datta of the Post Graduate Department of Botany. The lab mainly focusses on the analysis of the RNA Induced Silencing Complex. Recent highlights include the presentation of a paper at the RNAi World Congress.</p>

<p>More @ http://bioinfo-presiuniv.edu.in/index.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38472/gpsrdocker-docker-based-container-that-contain-all-softwareweb-servers-developed-in-the-field-of-bioinformatics</guid>
	<pubDate>Sun, 16 Dec 2018 13:04:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38472/gpsrdocker-docker-based-container-that-contain-all-softwareweb-servers-developed-in-the-field-of-bioinformatics</link>
	<title><![CDATA[gpsrdocker: docker-based container that contain all software/web servers developed in the field of bioinformatics.]]></title>
	<description><![CDATA[<p><span>GPSRdocker (</span><a href="http://webs.iiitd.edu.in/gpsrdocker/">http://webs.iiitd.edu.in/gpsrdocker/</a><span>) is&nbsp; Presently it contain software developed at G. P. S. Raghava's group (</span><a href="http://webs.iiitd.edu.in/raghava/">http://webs.iiitd.edu.in/raghava/</a><span>&nbsp;). </span></p>
<p><span>The programs and the package are free software for academic users. Permission to use, copy, and modify any part of this software for educational, research and non-profit purposes is hereby granted. In this package or Docker image, number of other supported software has been integrated which may be under other licenses, along with any direct or indirect dependencies of the primary software being contained. As for any pre-built image usage, it is the image user's responsibility to ensure that any use of this image complies with any relevant licenses for all software contained within. </span></p>
<p><span>All software packages are distributed in the hope that they will be useful but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. If you have any query, please contact at raghava@iiitd.ac.in.</span></p><p>Address of the bookmark: <a href="https://hub.docker.com/r/raghavagps/gpsrdocker/" rel="nofollow">https://hub.docker.com/r/raghavagps/gpsrdocker/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/2573/most-commonly-used-awk-by-bioinformatician</guid>
	<pubDate>Mon, 19 Aug 2013 01:12:38 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/2573/most-commonly-used-awk-by-bioinformatician</link>
	<title><![CDATA[Most Commonly used Awk by Bioinformatician]]></title>
	<description><![CDATA[<p style="text-align: center;">&nbsp;</p><p>Awk is a programming language that is specifically designed for quickly manipulating space delimited data. Although you can achieve all its functionality with Perl, awk is simpler in many practical cases.</p><p>Why awk? You can replace a pipeline of 'stuff | grep | sed | cut...' with a single call to awk. For a simple script, most of the timelag is in loading these apps into memory, and it's much faster to do it all with one. This is ideal for something like an openbox pipe menu where you want to generate something on the fly. You can use awk to make a neat one-liner for some quick job in the terminal, or build an awk section into a shell script. You can find a lot of online tutorials, but here I will only show a few examples which cover most of bioinformatician daily uses of awk.</p><p>choose rows where column 3 is larger than column 5:</p><p>awk '$3&gt;$5' input.txt &gt; output.txt</p><p>extract column 2,4,5:</p><p>awk '{print $2,$4,$5}' input.txt &gt; output.txt</p><p>awk 'BEGIN{OFS="\t"}{print $2,$4,$5}' input.txt</p><p>show rows between 20th and 80th:</p><p>awk 'NR&gt;=20&amp;&amp;NR&lt;=80' input.txt &gt; output.txt</p><p>calculate the average of column 2:</p><p>awk '{x+=$2}END{print x/NR}' input.txt</p><p>regex (egrep):</p><p>awk '/^test[0-9]+/' input.txt</p><p>calculate the sum of column 2 and 3 and put it at the end of a row or replace the first column:</p><p>awk '{print $0,$2+$3}' input.txt</p><p>awk '{$1=$2+$3;print}' input.txt</p><p>join two files on column 1:</p><p>awk 'BEGIN{while((getline&lt;"file1.txt")&gt;0)l[$1]=$0}$1 in l{print $0"\t"l[$1]}' file2.txt &gt; output.txt</p><p>count number of occurrence of column 2 (uniq -c):</p><p>awk '{l[$2]++}END{for (x in l) print x,l[x]}' input.txt</p><p>apply "uniq" on column 2, only printing the first occurrence (uniq):</p><p>awk '!($2 in l){print;l[$2]=1}' input.txt</p><p>count different words (wc):</p><p>awk '{for(i=1;i!=NF;++i)c[$i]++}END{for (x in c) print x,c[x]}' input.txt</p><p>deal with simple CSV:</p><p>awk -F, '{print $1,$2}'</p><p>substitution (sed is simpler in this case):</p><p>awk '{sub(/test/, "no", $0);print}' input.txt</p><p>&nbsp;</p><p>OK now here's where to read this stuff properly explained. roll</p><p>Two thorough tutorials:</p><p>http://www.gnu.org/software/gawk/manual/gawk.html</p><p>http://www.grymoire.com/Unix/Awk.html</p><p>A famous list of useful one-liners - though they're short, many are quite tricky:</p><p>http://www.pement.org/awk/awk1line.txt</p><p>And some nice explanations of those one-liners. After reading this you'll have a pretty good grasp!</p><p>http://www.catonmat.net/blog/awk-one-li &hellip; -part-one/</p><p>http://www.catonmat.net/blog/ten-awk-ti &hellip; -pitfalls/</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>