<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32465?offset=370</link>
	<atom:link href="https://bioinformaticsonline.com/related/32465?offset=370" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/2573/most-commonly-used-awk-by-bioinformatician</guid>
	<pubDate>Mon, 19 Aug 2013 01:12:38 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/2573/most-commonly-used-awk-by-bioinformatician</link>
	<title><![CDATA[Most Commonly used Awk by Bioinformatician]]></title>
	<description><![CDATA[<p style="text-align: center;">&nbsp;</p><p>Awk is a programming language that is specifically designed for quickly manipulating space delimited data. Although you can achieve all its functionality with Perl, awk is simpler in many practical cases.</p><p>Why awk? You can replace a pipeline of 'stuff | grep | sed | cut...' with a single call to awk. For a simple script, most of the timelag is in loading these apps into memory, and it's much faster to do it all with one. This is ideal for something like an openbox pipe menu where you want to generate something on the fly. You can use awk to make a neat one-liner for some quick job in the terminal, or build an awk section into a shell script. You can find a lot of online tutorials, but here I will only show a few examples which cover most of bioinformatician daily uses of awk.</p><p>choose rows where column 3 is larger than column 5:</p><p>awk '$3&gt;$5' input.txt &gt; output.txt</p><p>extract column 2,4,5:</p><p>awk '{print $2,$4,$5}' input.txt &gt; output.txt</p><p>awk 'BEGIN{OFS="\t"}{print $2,$4,$5}' input.txt</p><p>show rows between 20th and 80th:</p><p>awk 'NR&gt;=20&amp;&amp;NR&lt;=80' input.txt &gt; output.txt</p><p>calculate the average of column 2:</p><p>awk '{x+=$2}END{print x/NR}' input.txt</p><p>regex (egrep):</p><p>awk '/^test[0-9]+/' input.txt</p><p>calculate the sum of column 2 and 3 and put it at the end of a row or replace the first column:</p><p>awk '{print $0,$2+$3}' input.txt</p><p>awk '{$1=$2+$3;print}' input.txt</p><p>join two files on column 1:</p><p>awk 'BEGIN{while((getline&lt;"file1.txt")&gt;0)l[$1]=$0}$1 in l{print $0"\t"l[$1]}' file2.txt &gt; output.txt</p><p>count number of occurrence of column 2 (uniq -c):</p><p>awk '{l[$2]++}END{for (x in l) print x,l[x]}' input.txt</p><p>apply "uniq" on column 2, only printing the first occurrence (uniq):</p><p>awk '!($2 in l){print;l[$2]=1}' input.txt</p><p>count different words (wc):</p><p>awk '{for(i=1;i!=NF;++i)c[$i]++}END{for (x in c) print x,c[x]}' input.txt</p><p>deal with simple CSV:</p><p>awk -F, '{print $1,$2}'</p><p>substitution (sed is simpler in this case):</p><p>awk '{sub(/test/, "no", $0);print}' input.txt</p><p>&nbsp;</p><p>OK now here's where to read this stuff properly explained. roll</p><p>Two thorough tutorials:</p><p>http://www.gnu.org/software/gawk/manual/gawk.html</p><p>http://www.grymoire.com/Unix/Awk.html</p><p>A famous list of useful one-liners - though they're short, many are quite tricky:</p><p>http://www.pement.org/awk/awk1line.txt</p><p>And some nice explanations of those one-liners. After reading this you'll have a pretty good grasp!</p><p>http://www.catonmat.net/blog/awk-one-li &hellip; -part-one/</p><p>http://www.catonmat.net/blog/ten-awk-ti &hellip; -pitfalls/</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36483/popular-bioinformatics-educational-resources</guid>
	<pubDate>Fri, 04 May 2018 19:43:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36483/popular-bioinformatics-educational-resources</link>
	<title><![CDATA[Popular bioinformatics educational resources !]]></title>
	<description><![CDATA[<p>Followings are the list of popular bioinformatics educational resources</p><p><a href="http://Bii.a-star.edu.sg"><strong>Bii.a-star.edu.sg</strong></a></p><p>Bio research and development. Has course information and research information.</p><p><a href="http://Isb-sib.ch"><strong>Isb-sib.ch</strong></a></p><p>SIB operates the ExPASy proteomics server and the Swiss node of EMBnet. Teaching activities include a series of post-graduate courses given at the Universities of Geneva and Lausanne, as well as at the EPFL, and a Masters Degree in bioinformatics. Major research areas include the development of integrated databases and software resources in the field of proteomics.</p><p><a href="http://Bioinformatics.ca"><strong>Bioinformatics.ca</strong></a></p><p>Provides information about bioinformatics in Canada. Workshops, certification and resources.</p><p><a href="http://Chickscope.beckman.uiuc.edu"><strong>Chickscope.beckman.uiuc.edu</strong></a></p><p>Students raise chicken embryos in the classroom and obtain magnetic resonance images through the Internet.</p><p><a href="http://Bcb.iastate.edu"><strong>Bcb.iastate.edu</strong></a></p><p>Graduate program at Iowa State University offering Undergraduate Major (BCBio) and the PhD program (BCB).</p><p><a href="http://Bu.edu/bioinformatics/"><strong>Bu.edu/bioinformatics/</strong></a></p><p>Interdisciplinary PhD and Masters Programs that include an internship in the local industry companies. In conjunction with the NE masters program.</p><p><a href="http://Bioinformatics.ubc.ca"><strong>Bioinformatics.ubc.ca</strong></a></p><p>A computational biology research centre covering many areas of genomics, proteomics, computer science and statistics. Research, training, news and events, resources and support, director's message, faculty and personnel.</p><p><a href="http://Openhelix.com"><strong>Openhelix.com</strong></a></p><p>Provides onsite training on specific bioinformatics databases and tools. Also offers bioinformatic software testing and research consulting services.</p><p><a href="http://Igb.uci.edu"><strong>Igb.uci.edu</strong></a></p><p>Specializing in making publicly available software and database services for computational biology.</p><p><a href="http://Bioinformatics.pe.kr"><strong>Bioinformatics.pe.kr</strong></a></p><p>Maintained by Dr. Seyeon Weon, Korea providing information on courses, a database archive, software archive and online resources.</p><p><a href="http://Groups.yahoo.com/group/bimatics/"><strong>Groups.yahoo.com/group/bimatics/</strong></a></p><p>Bioinformatics group for students interested and/or working in the bioinformatics/computationalbiology fields. Offers opportunities to exchanging information and sharing ideas.</p><p><a href="http://Ncbi.nlm.nih.gov/books/NBK22183/"><strong>Ncbi.nlm.nih.gov/books/NBK22183/</strong></a></p><p>Information about several medically important genes and related diseases. Illustrates the use of bioinformatics in their study.</p><p><a href="http://Bioinfo.mbb.yale.edu/mbb452a/2003/"><strong>Bioinfo.mbb.yale.edu/mbb452a/2003/</strong></a></p><p>Bioinformatics course at Yale University. All course slides are available online.</p><p><a href="http://Cs.iastate.edu/~honavar/comp-bio-courses.html"><strong>Cs.iastate.edu/~honavar/comp-bio-courses.html</strong></a></p><p>Listing of computational molecular biology course pages that have extensive online course materials.</p><p><a href="http://Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html"><strong>Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html</strong></a></p><p>A web-based tutorial associated with "Introduction to bioinformatics" published by Addison Wesley Longman.</p><p><a href="http://Northeastern.edu/bioinformatics/"><strong>Northeastern.edu/bioinformatics/</strong></a></p><p>From the Biology department and in cooperation with Boston University. Emphasis on the ability to integrate knowledge from biological, computational, and mathematical disciplines.</p><p><a href="http://Biocomp.unibo.it/lsbioinfo/"><strong>Biocomp.unibo.it/lsbioinfo/</strong></a></p><p>A two year, international master's programme in bioinformatics at the Universita di Bologna, Italy.</p><p><a href="http://Cs.helsinki.fi/bioinformatiikka/mbi/programme.html"><strong>Cs.helsinki.fi/bioinformatiikka/mbi/programme.html</strong></a></p><p>A two year Masters Degree Programme in Bioinformatics (MBI) offered by the University of Helsinki and Helsinki University of Technology, Finland.</p><p><a href="http://Ornl.gov/sci/techresources/Human_Genome/education/education.shtml"><strong>Ornl.gov/sci/techresources/Human_Genome/education/education.shtml</strong></a></p><p>A resource for introductory information on the Human Genome Project.</p><p><a href="http://His.se/bioinformatics"><strong>His.se/bioinformatics</strong></a></p><p>A one-year, international master's programme in bioinformatics at the University of Skovde, Sweden.</p><p><a href="http://Members.tripod.com/C.elegans/"><strong>Members.tripod.com/C.elegans/</strong></a></p><p>Resources in biochemical, molecular, cellular, system, and organism biology, including over 25,000 indexed links, accumulated since 2000, from topic menus or from search interface.</p><p><a href="http://Bioinformatics.org/faq/#contents"><strong>Bioinformatics.org/faq/#contents</strong></a></p><p>Summary of basics of bioinformatics for the intelligent newcomer.</p><p><a href="http://Jiscmail.ac.uk/archives/bioinformatics.html"><strong>Jiscmail.ac.uk/archives/bioinformatics.html</strong></a></p><p>Forum featuring various aspects, events and developments in the bioinformatics field.</p><p><a href="http://Biinoida.blogspot.com"><strong>Biinoida.blogspot.com</strong></a></p><p>Blog focusing on bioinformatics, biotechnology, pharma regulatory affairs, IPR and clinical trials.</p><p><a href="http://Colorbasepair.com/bioinformatics_courses_tutorials.html"><strong>Colorbasepair.com/bioinformatics_courses_tutorials.html</strong></a></p><p>A list of on-line course materials and tutorials for bioinformatics and computational biology.</p><p><a href="http://Geospiza.com/education/"><strong>Geospiza.com/education/</strong></a></p><p>Instructional materials for teaching bioinformatics. These include animated tutorials on topicssuch as BLAST, finding mutations in a protein, and graphing with MS-Excel.</p><p><a href="http://Bioinformatics.fi"><strong>Bioinformatics.fi</strong></a></p><p>An international, two-year Master's programme jointly managed by the University of Tampere and the University of Turku, Finland.</p><p><a href="http://Perlsource.net"><strong>Perlsource.net</strong></a></p><p>Provides online courses in Perl programming for bioinformatic tools.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4106/phd-at-national-institute-for-research-in-reproductive-health</guid>
  <pubDate>Fri, 30 Aug 2013 04:50:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[PhD at National Institute for Research in Reproductive Health]]></title>
  <description><![CDATA[
<p>National Institute for Research in Reproductive Health</p>

<p>(Indian Council of Medical Research )<br />Jehangir Merwanji Street, Parel, Mumbai 400 012</p>

<p>Advertisement No. 1/NIRRH/Ph.D. 2013<br />Admission to Ph.D. Programme – 2013</p>

<p>National Institute for Research in Reproductive Health, Mumbai, a premier institute of the Indian Council of Medical Research, conducts basic, clinical and operational research in different areas of reproductive health. The thrust areas of research include: Fertility Regulation, Infertility and Reproductive Disorders, Reproductive Tract Infections, Maternal and Child Health, Osteoporosis, Genetic Disorders, Stem Cell Biology, Structural Biology, Bioinformatics and Reproductive Toxicology. Institute is affiliated to the University of Mumbai for the award of Ph.D. degree in Applied Biology, Biochemistry, Life Sciences and Biotechnology. The institute invites applications from young and bright students for enrollment in Ph.D. programme.</p>

<p>More at http://www.nirrh.res.in/announcements/phd_program_2013.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38472/gpsrdocker-docker-based-container-that-contain-all-softwareweb-servers-developed-in-the-field-of-bioinformatics</guid>
	<pubDate>Sun, 16 Dec 2018 13:04:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38472/gpsrdocker-docker-based-container-that-contain-all-softwareweb-servers-developed-in-the-field-of-bioinformatics</link>
	<title><![CDATA[gpsrdocker: docker-based container that contain all software/web servers developed in the field of bioinformatics.]]></title>
	<description><![CDATA[<p><span>GPSRdocker (</span><a href="http://webs.iiitd.edu.in/gpsrdocker/">http://webs.iiitd.edu.in/gpsrdocker/</a><span>) is&nbsp; Presently it contain software developed at G. P. S. Raghava's group (</span><a href="http://webs.iiitd.edu.in/raghava/">http://webs.iiitd.edu.in/raghava/</a><span>&nbsp;). </span></p>
<p><span>The programs and the package are free software for academic users. Permission to use, copy, and modify any part of this software for educational, research and non-profit purposes is hereby granted. In this package or Docker image, number of other supported software has been integrated which may be under other licenses, along with any direct or indirect dependencies of the primary software being contained. As for any pre-built image usage, it is the image user's responsibility to ensure that any use of this image complies with any relevant licenses for all software contained within. </span></p>
<p><span>All software packages are distributed in the hope that they will be useful but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. If you have any query, please contact at raghava@iiitd.ac.in.</span></p><p>Address of the bookmark: <a href="https://hub.docker.com/r/raghavagps/gpsrdocker/" rel="nofollow">https://hub.docker.com/r/raghavagps/gpsrdocker/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4081/csir-institute-of-genomics-integrative-biology</guid>
  <pubDate>Thu, 29 Aug 2013 05:22:03 -0500</pubDate>
  <link></link>
  <title><![CDATA[CSIR-INSTITUTE OF GENOMICS &amp; INTEGRATIVE BIOLOGY]]></title>
  <description><![CDATA[
<p>CSIR-INSTITUTE OF GENOMICS &amp; INTEGRATIVE BIOLOGY, Mall Road, Delhi 110007</p>

<p>POSITIONS OPEN FOR TEMPORARY RESEARCH PROJECT POSTS</p>

<p>(Date of interview 23rd September 2013 at 10:30 AM)</p>

<p>CSIR-Institute of Genomics &amp; Integrative Biology (IGIB), desires to engage qualified incumbents on purely temporary basis as detailed below:</p>

<p>Project Code/Title (Project Code BSC0123)</p>

<p>Genome dynamics in Cellular Organization, Differentiation and Enantiostasis (GENCODE)</p>

<p>Project Fellow<br />	<br />First Class M.Sc./M.Tech in bioinformatics/Human Genetics/Genomics</p>

<p>Rs. 16,000/- + 30 % HRA per month</p>

<p>Sr. Project Fellow	</p>

<p>First Class M.Sc./M.Tech in bioinformatics/Human Genetics/Genomics</p>

<p>With two years of experience in NGS data analysis.</p>

<p>Rs. 18,000/- + 30 % HRA per month</p>

<p>Age relaxation as per Govt. of India instructions.</p>

<p>Engagement is for the project and on behalf of the funding agency and the tenure shall be as mentioned above. The duration of the post is initially for One year or till the closing date of the project, whichever is earlier. Tenure may be extendable up to project duration. Contract may be terminated at any time by giving one-month notice by either side. The applicants will have no claim implicit or explicit for consideration against any CSIR/IGIB post.</p>

<p>How to Apply:</p>

<p>It is mandatory for eligible applicants to apply by both the processes as given below:</p>

<p>1.    Sending the resume in MS Word format directly to hrd@igib.res.in (Mentioning the Project Code-Post Code in the Subject Line of the email example:GAP0059-1)</p>

<p>2.    They also need to fill up proforma by clicking on the following link HR Online Form.</p>

<p>3.    Candidate cannot apply for more than two posts.</p>

<p>Last date of receiving application is 02-09-2013.</p>

<p>No application would be entertained with result awaited status or after due date.</p>

<p>The email will be sent to the short listed candidates.</p>

<p>No TA/DA will be paid to the candidates to attend the interview. The engagement shall be as per guidelines of CSIR/Funding agency. Candidates will have an option to give reply in Hindi.</p>

<p>Note: The shortlisted candidates, who will receive the email for interview, have to report at 09:00 AM on the day of interview along with any Photo ID card and original certificates for entry purpose. Entry will be closed by 10:00 AM.</p>

<p>More @ http://www.igib.res.in/sites/default/files/23092013.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39472/louisiana-biomedical-research-network-summer-bioinformatics-training-program</guid>
	<pubDate>Wed, 05 Jun 2019 15:30:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39472/louisiana-biomedical-research-network-summer-bioinformatics-training-program</link>
	<title><![CDATA[Louisiana Biomedical Research Network: Summer Bioinformatics Training Program]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/06/LBRN-Summer-Program1-CCT.jpg" alt="2019 summer bioinformatics training program" width="600" height="337.5" style="border: 0px;"></p><p>Louisiana Biomedical Research Network (LBRN) announces registration for it's Summer 2019 Bioinformatics Training Program. The program will be focused on processing, analysis and interpretation of next generation sequecning data for biologists. Learn more:</p><p>https://edu.t-bio.info/louisiana-biomedical-research-network-summer-2019-lbrn-bioinformatics-training-program/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/3013/python-and-biopython-tutorial</guid>
	<pubDate>Fri, 23 Aug 2013 06:47:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/3013/python-and-biopython-tutorial</link>
	<title><![CDATA[Python and BioPython Tutorial]]></title>
	<description><![CDATA[<p>A quickstart tutorial that allows to become familiar with the Python language. The exercises expect knowledge of basic concepts of programming. A group of 2nd year computer science students with no previous Python knowledge required 60'-90' to complete the exercises. With about 3 hours time, the exercise is suitable for non-programmers as well.</p><p>Address of the bookmark: <a href="http://www.biotnet.org/training-materials/python-programmers" rel="nofollow">http://www.biotnet.org/training-materials/python-programmers</a></p>]]></description>
	<dc:creator>Manshi Raghubanshi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</guid>
	<pubDate>Thu, 10 Oct 2019 22:12:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</link>
	<title><![CDATA[Naegleria fowleri: brain eating amoebae]]></title>
	<description><![CDATA[<div><em>Naegleria fowleri</em>&nbsp;is a free living, universally distributed amoeba, which is mostly found in natural, stagnant, warm water bodies such as ponds, lakes, etc. It is also reported to be present even in indoor water bodies, such as swimming pools within a temperature range of 40&ndash;45&deg;C.&nbsp;</div><div>&nbsp;</div><div><img src="https://d.newsweek.com/en/full/351971/naegleria-fowleri.jpg" alt="image" width="720" height="634" style="border: 0px; border: 0px;">&nbsp;</div><div><em style="font-size: 12.8px;">N. fowleri</em>&nbsp;infects the central nervous system of human body by entering through the nose during swimming and outdoor baths in natural stagnant water bodies, leading to meningoencephalitis. It is a condition of inflammation of cerebral tissues and membranes of the brain and is mostly fatal in nature. Casualties due to N. fowleri infections are reported all across the globe including a few in India but only seven survivors in the entire world have been reported till 2015.</div><div>&nbsp;</div><div>You can find two genome assembly at&nbsp;</div><div><a href="https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri">https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri</a></div><div>&nbsp;</div><div>More at&nbsp;<a href="https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri">https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri</a></div>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/3967/research-project-posts-for-csir-project-delhi</guid>
  <pubDate>Tue, 27 Aug 2013 04:31:41 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Project Posts for CSIR Project, Delhi]]></title>
  <description><![CDATA[
<p>Positions Open For Temporary Research Project Posts for CSIR Project, Delhi<br />CSIR is looking for bright young candidates to get involved in building algorithms and platforms for large biological data analyses in the areas of comparative genomics, computational workflows, disease association studies, simulating virtual organelles, etc. Anyone who fulfills the eligibility criteria mentioned below may appear for a walk-in interview on 3rd September 2013 at CSIR Headquarters, Anusandhan Bhawan, 2 Rafi Marg, Delhi – 110001.<br />you can go to link for details or download PDF</p>

<p>http://www.csir.res.in/External/Heads/aboutcsir/announcements/ProjectPost_130813.pdf</p>
]]></description>
</item>

</channel>
</rss>