<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32481?offset=790</link>
	<atom:link href="https://bioinformaticsonline.com/related/32481?offset=790" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12988/guest-lecturer-molecular-biology-bioinformatics</guid>
  <pubDate>Wed, 23 Jul 2014 13:34:41 -0500</pubDate>
  <link></link>
  <title><![CDATA[Guest Lecturer - Molecular Biology &amp; Bioinformatics]]></title>
  <description><![CDATA[
<p>Adv. No. F.TU/ACA/GT-APP/01/14 Date: 07.07.2014</p>

<p>Faculty of Science</p>

<p>Essential Qualifications:</p>

<p>(i) Good academic record having at least 55% marks (or an equivalent grade in a point scale wherever grading system is followed) at the Master’s Degree level in a relevant subject, from an Indian University, or an equivalent degree from an accredited foreign University.</p>

<p>(II) Besides fulfilling the above qualifications, the candidates must have cleared the National Eligibility Test (NET) conducted by the UGC, CSIR or similar test accredited by the UGC like SLET/SET.</p>

<p>(III) Notwithstanding anything contained in sub-clauses (i) and (ii) of clause 4.4.1 of UGC regulations 2010, candidates, who are, or have been awarded a Ph.D. Degree in accordance with the University Grants Commission (Minimum Standards and Procedure for Award of Ph.D. Degree) Regulations, 2009, shall be exempted from the requirement of the minimum eligibility condition of NET/ SLET/ SET for engagement of guest Teacher.</p>

<p>(IV) NET/ SLET/ SET shall also not be required for such Master’s Degree Programmes in discipline for which NET/ SLET/ SET is not conducted.</p>

<p>Application form along with detailed instructions can be downloaded from Tripura University website: www.tripurauniv.in. The duly filled in application forms complete in all respects may be sent so as to reach the Office of the Deputy Registrar Academic Branch, Tripura University, Suryamaninagar - 799022, Tripura on or before 31st July, 2014. The Candidates who responded against advertisement No. TU.REG/N-Advt./02/10 dated 20.02.2014 need not apply again.</p>

<p>For more info visit: http://www.tripurauniv.in/images/universitymedia/EmploymentNotification/Guest%20Teacher%20Advt.%20website_09072014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12936/assistant-professor-medical-bioinformatics</guid>
  <pubDate>Wed, 23 Jul 2014 05:00:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor - Medical Bioinformatics]]></title>
  <description><![CDATA[
<p>Advt. No : ME-I/A-IV/03/14</p>

<p>No.of Posts:01 (SC)</p>

<p>Pay Scale:</p>

<p>Pay Band of Rs.15600-39100 + Rs.6000/- GP +NPA @ 25% of Basic Pay +Learning Resource Allowance @ Rs.20,000/-P.A.+ Conveyance Allowance @ Rs. 1650/-P.M.+ Academic Allowance @ Rs.2500/- P.M. and other admissible allowances.</p>

<p>Qualifications:</p>

<p>Area of Specialization:-</p>

<p>Bioinformatics/Computational/Biology/Genomics/ Proteomics/ Structural Biology</p>

<p>1. Postgraduate qualification, e.g. Master’s Degree in Biotechnology/Bioinformatics/ Biophysics.</p>

<p>2. A Doctorate Degree of recognized University/Institute in a basic or allied Medical Science subject e.g. Medical Biotechnology/Biophysics. Bioinformatics/X-ray Crystallography/</p>

<p>Immunology/Structural Biology etc</p>

<p>Experience:</p>

<p>1.Minimum three years teaching and/or research experience in a recognized medical/research Institution in an allied medical subject after obtaining doctorate degree and preferably in Medical</p>

<p>Molecular Biology/ Biophysics/Structural Biology/Genomics and Clinical Proteomics/Computational Biology.</p>

<p>2. Minimum two publication with atleast one in international journal and atleast one as first author</p>

<p>Desirable:-</p>

<p>Consistently excellent scholastic/academic record, demonstrated ability to write grant proposal/(s) successfully, Post Doctoral training in a frontier area of medical Bioinformatics Research and of direct relevance to clinical diagnosis or patient care (preferably from a recognized top-ranking medical institution abroad)</p>

<p>Send your applications to O/O, Deputy Registrar, Recruitment &amp; Establishment Cell, University of Health Sciences, Rohtak by 08.7.2014</p>

<p>For more details,please visit website:http://pgimsrohtak.nic.in/2014%20AP%20Advt.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/13025/the-5-reasons-to-mistakes-at-bioinformatics-work</guid>
	<pubDate>Thu, 24 Jul 2014 02:51:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/13025/the-5-reasons-to-mistakes-at-bioinformatics-work</link>
	<title><![CDATA[The 5 reasons to mistakes at bioinformatics work !!!]]></title>
	<description><![CDATA[<p>When you're just starting out with biological programming, it's easy to run into complex problems that make you wonder how anyone has ever managed to write a program. There are some problems that trip up nearly every bioinformatician--everything from getting started understanding the biological problems to dealing with program design. Some random mistakes are so prominent that even experienced biological programmers do it. The 8 years in bioinformatics and my few random observations, most of them are snarky. These reasons will always take longer than expected and compel you to postpone your project deadline.</p><p><strong>1.Stupid for biologist:</strong> Biology is so complex that it will make bioinformatician feel stupid. There are no any universal fixed rules; it can surprise you any time. So be nice to biologists who ask questions and resolve your biological puzzles. Sometime you will have no idea what the hell you were doing either.<br /><br /><strong>2.Puzzling why:</strong> Do not hesitate to ask question. Especially. at the beginning of project you will have to ask a lot of questions. Instead of puzzling it out at end check out and clear your doubt even for a single error. It may can leads to wrong conclusion.<br /><br /><strong>3.Running marathon:</strong> The most of the biological software&rsquo;s documentation is always incomplete. In other word they are no more than 95 percent complete. Sometime a single problem can halt your entire project for months. Compilation and running the pipelines in tedious because almost all are interdependent and need proper configuration. I face the same kind of problem with Evolver :( &hellip; <br /><br /><strong>4.Folders missing:</strong> The pipelines generate lots of data, and we keep them in several folders for future use. But sometime we delete them by mistake and move to recovery&hellip;<br /><br /><strong>5.Digging deeper:</strong> Digging deeper is fruitful, but some time it can be catastrophic. You may get frustrated or direction less. So keep a biologist with you for rescue &hellip;. Sometime an expert computer programmer to handle your server. Remember, the server will always go down when you need it the most.<br /><br />The most common frustrating&nbsp; common line: Why do we do this again?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13337/phd-opportunity-at-universite-de-liege-belgium</guid>
  <pubDate>Sat, 02 Aug 2014 01:12:43 -0500</pubDate>
  <link></link>
  <title><![CDATA[PhD opportunity at Université de Liège - Belgium]]></title>
  <description><![CDATA[
<p>PhD opportunity at Université de Liège - Belgium</p>

<p>The Bioinformatics and Systems Biology Unit of Université de Liège (Belgium) is looking for a highly motivated master student with programming skills for a PhD thesis project (4 years, fully funded) with the goal of designing computational tools that use literature, genomic and structural data in order to infer regulatory and metabolic networks.  </p>

<p>Applicants are invited to send their resume and a recommendation letter to Prof. Patrick Meyer (more details at   www.biosys.ulg.ac.be )</p>

<p>For more information : www.biosys.ulg.ac.be</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/13523/megadock-40</guid>
	<pubDate>Thu, 07 Aug 2014 18:08:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/13523/megadock-40</link>
	<title><![CDATA[MEGADOCK 4.0]]></title>
	<description><![CDATA[<p>An ultra&ndash;high-performance protein&ndash;protein docking software for heterogeneous supercomputers</p>
<p id="p-4"><strong>Summary:</strong> The application of protein&ndash;protein docking in large-scale interactome analysis is a major challenge in structural bioinformatics and requires huge computing resources. In this work, we present MEGADOCK 4.0, an FFT-based docking software that makes extensive use of recent heterogeneous supercomputers and shows powerful, scalable performance of over 97% strong scaling.</p>
<p id="p-5"><strong>Availability and Implementation:</strong> MEGADOCK 4.0 is written in C++ with OpenMPI and NVIDIA CUDA 5.0 (or later) and is freely available to all academic and non-profit users at: <a href="http://www.bi.cs.titech.ac.jp/megadock">http://www.bi.cs.titech.ac.jp/megadock</a>.</p>
<p id="p-6"><strong>Contact:</strong> <a href="mailto:akiyama@cs.titech.ac.jp">akiyama@cs.titech.ac.jp</a></p><p>Address of the bookmark: <a href="http://bioinformatics.oxfordjournals.org/content/early/2014/08/06/bioinformatics.btu532.short" rel="nofollow">http://bioinformatics.oxfordjournals.org/content/early/2014/08/06/bioinformatics.btu532.short</a></p>]]></description>
	<dc:creator>Suleman Khan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/14024/grapher</guid>
	<pubDate>Thu, 14 Aug 2014 14:02:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/14024/grapher</link>
	<title><![CDATA[GrapheR !!!]]></title>
	<description><![CDATA[<p>What a wonderful gem <em>GrapheR</em> is.... Oh yes it is. <em>GrapheR</em> is a GUI for base graphics in R by http://www.maximeherve.com/. The package provides a graphical user interface for creating base charts in R. It is ideal for beginners in R, as the user interface is very clear and the code is written along side into a text file, allowing users to recreate the charts directly in the console. <br /><br />Adding and changing legends? Messing around with the plotting window settings? It is much easier/quicker with this GUI than reading the help file and trying to understand the various parameters.<br />Here is a little example using the iris data set.<br /><br />library(GrapheR)<br />data(iris)<br />run.GrapheR()<br /><br />This will bring up a window that helps me to create the chart and tweak the various parameters.</p><p><img src="http://4.bp.blogspot.com/-NbnCM1dPh3E/U9aW9YxJ9oI/AAAAAAAABgo/gEPzPhOpf2Y/s1600/GrapheR.png" alt="image" width="878" height="868" style="border: 0px; border: 0px;"><br /><br />Finally, I find the underlying R code in a file created by <em>GrapheR</em>. For more details read also the <a href="http://cran.r-project.org/web/packages/GrapheR/index.html" target="_blank">package vignette</a>, which is available in <a href="http://cran.r-project.org/web/packages/GrapheR/vignettes/manual_en.pdf" target="_blank">English</a>, <a href="http://cran.r-project.org/web/packages/GrapheR/vignettes/manual_fr.pdf" target="_blank">French</a> and <a href="http://cran.r-project.org/web/packages/GrapheR/vignettes/manual_de.pdf" target="_blank">German</a>!</p>]]></description>
	<dc:creator>John Parker</dc:creator>
</item>

</channel>
</rss>