<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32709?offset=750</link>
	<atom:link href="https://bioinformaticsonline.com/related/32709?offset=750" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/22352/affy-has-acquired-eureka-genomics-for-15m</guid>
	<pubDate>Wed, 20 May 2015 15:11:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/22352/affy-has-acquired-eureka-genomics-for-15m</link>
	<title><![CDATA[Affy has acquired Eureka Genomics for 15M $]]></title>
	<description><![CDATA[<p>Affymetrix Acquires Assets Of Eureka Genomics Corporation To Provide High Throughput And Economical Crop And Animal Genotyping</p><p>http://www.thestreet.com/story/13151062/1/affymetrix-acquires-assets-of-eureka-genomics-corporation-to-provide-high-throughput-and-economical-crop-and-animal-genotyping.html</p>]]></description>
	<dc:creator>Martin Jones</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22402/alessandra-carbone-lab</guid>
  <pubDate>Tue, 26 May 2015 08:54:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Alessandra Carbone Lab]]></title>
  <description><![CDATA[
<p>Our group works on various problems connected with the functioning and evolution of biological systems. We use mathematical tools, coming from statistics and combinatorics, algorithmic tools and molecular physics tools to study basic principles of cellular functioning starting from genomic data. We run several projects in parallel, all aiming at understanding the basic principles of evolution and co-evolution of molecular structures in the cell. They are intimately linked to each other.</p>

<p>Our main research themes are:</p>

<p>Domain annotation and metagenomics <br />Transcriptomics and sequence analysis<br />Protein evolution and interactions<br />Protein conformational dynamics</p>

<p>More at http://www.lcqb.upmc.fr/AnalGenom/home.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22414/x-shirley-liu-lab</guid>
  <pubDate>Tue, 26 May 2015 17:28:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[X. Shirley Liu Lab]]></title>
  <description><![CDATA[
<p>The research in our laboratories are focused on the following three areas: </p>

<p>Bioinformatics<br />Cancer<br />Epigenetics</p>

<p>More at http://liulab.dfci.harvard.edu/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22436/ra-bioinformatics-at-national-bureau-of-animal-genetic-resources</guid>
  <pubDate>Thu, 28 May 2015 19:25:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at NATIONAL BUREAU OF ANIMAL GENETIC RESOURCES]]></title>
  <description><![CDATA[
<p>NATIONAL BUREAU OF ANIMAL GENETIC RESOURCES</p>

<p>Near Basant Vihar G.T. Road Bypass P.O. Box No.129</p>

<p>Karnal - 132001 (Haryana)</p>

<p>WALK-IN-INTERVIEW</p>

<p>A walk-in-Interview is proposed to be held at National Bureau of Animal Genetic Resources, Karnal (Haryana)-132001 at 10:30 AM on 10.06.2015 to select One Research Associate as per details given below:</p>

<p>1. One post of Research Associate under National Fellow project entitled “Genome data mining to unravel molecular basis of thermotolerance and adaptation to diverse environments in native cattle and buffaloes”.</p>

<p>The post duration is Upto 22.05.2016 or earlier &amp; Co-terminus with the project.</p>

<p>Essential Qualifications: Master’s degree (M.Sc. / M.V.Sc.) in Biotechnology/ Animal Genetics and Breeding/ Life Sciences/ Bioinformatics with 2 Years research experience in relevant subject or Ph.D in any of the above subjects.</p>

<p>Desirable: Working Experience in molecular biology, gene expression/ microarray data analysis, SNP genotyping and sequence data analysis, mammalian cell-culture handling etc.</p>

<p>Emolument: Rs. 23,000/- per month + HRA as per admissibility</p>

<p>Research Associate: ONE</p>

<p>Duration of engagement: Upto 22.05.2016 or earlier Co-terminus with the project</p>

<p>Age Limit:  40 years for Men  45 years for women as on date of interview</p>

<p>Note: Relaxation in age will be admissible for SC/ST &amp; OBC candidates as per Govt. of India /ICAR norms</p>

<p>1. The applicants must bring with them original documents and brief of research work done during post graduation along with a set of photocopy and latest two passport size photographs. 2. A panel of selected candidates will also be made which may be utilized for filling of positions of shorter durations in future if demand arises. 3. Experience certificate in original, if any 4. The above positions are purely on temporary basis and are coterminus with the project. No TA/DA will be paid to attend the interview. 5. Any other clarifications can be had on the date of interview. 6. The Director’s decision will be final and binding on all respects.</p>

<p>Advertisement: http://210.212.93.85/RAadvertisiment.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22965/ra-bioinformatics-at-bharathidasan-university</guid>
  <pubDate>Sun, 28 Jun 2015 12:21:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Bharathidasan University]]></title>
  <description><![CDATA[
<p>National Facility for Marine Cyanobacteria <br />Department of Marine Biotechnology <br />Bharathidasan University <br />Tiruchirappalli -620024, Tamil Nadu </p>

<p>Applications are invited from individuals who have high motivation to do research for the below mentioned position, </p>

<p>1. Research Associate - 1 No. <br />in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24. </p>

<p>Title of the Project: “Establishment of National Repository for Micro algae &amp; Cyanobacteria” funded by Department of Biotechnology, Govt. of India </p>

<p>Qualification </p>

<p>1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA </p>

<p>Essential : Doctoral degree in relevant subject from recognized University/ Institutes <br />Desirable: Research experience in molecular biology and bioinformatics </p>

<p>Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.</p>

<p>Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23627/ra-bioinformatics-at-nipgr</guid>
  <pubDate>Tue, 04 Aug 2015 18:53:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at NIPGR]]></title>
  <description><![CDATA[
<p>Applications are invited from suitable candidates for filling up one position of Research Associate (RA) in the Institute with Dr. Senthil-Kumar Muthappa, Scientist, NIPGR, in the scheme of "Short-Term Research Fellowship" programme. The position is completely on temporary basis with maximum duration of three years. The initial appointment will be for a period of one year, which can be curtailed or extended based on the performance of the candidate and discretion of the Competent Authority.</p>

<p>The candidate is expected to have experience in handling functional genomics tools to dissect defense responses against bacterial pathogens and drought stress tolerance. This project may involve use of bioinformatics tools, database development, large scale transcriptome profiling, virus-induced gene silencing and any other research work as assigned by the PI.</p>

<p>Qualification: Candidates having a Ph. D. degree in Bioinformatics/Plant Molecular Biology/Plant Physiology/Plant Pathology/Plant Breeding &amp; Genetics and strong publication record can apply. Candidates having prior work experience in using advanced molecular biology tools in laboratory with strong bioinformatics knowledge are preferred.</p>

<p>The Fellowship amount for the position will be given at par with the similar fellowships by DBT/DST.</p>

<p>NIPGR reserves the right to select the candidate against the above post depending upon the qualifications and experience of the candidate. Reservation of post shall be as per Govt. of India norms.</p>

<p>Eligible candidates may apply by sending hard copy of complete application in the given format with a cover letter showing interest and specifying the position. The attested copies of the mark-sheets, certificates, proof of research experience/publications are to be attached. The application should reach at the address given below within 15 days from the date of advertisement. The envelope must be superscribed by "Application for the post of RA under NIPGR Short-term research fellowship programme". No TA/DA will be paid for attending the interview.</p>

<p>ONLY hard copy of the application in the given format will be accepted.<br />www.nipgr.res.in/files/careers/format_RA2.doc</p>

<p>Dr. Senthil-Kumar Muthappa<br />Staff Scientist - III,<br />National Institute of Plant Genome Research (NIPGR)<br />Aruna Asaf Ali Marg, P.O. Box NO. 10531,<br />New Delhi - 110067</p>
]]></description>
</item>

</channel>
</rss>