<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32719?offset=1170</link>
	<atom:link href="https://bioinformaticsonline.com/related/32719?offset=1170" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4155/genetics-for-fun-and-profit-andrew-hessel-at-tedxvilnius</guid>
	<pubDate>Sun, 01 Sep 2013 19:15:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4155/genetics-for-fun-and-profit-andrew-hessel-at-tedxvilnius</link>
	<title><![CDATA[Genetics for Fun and Profit: Andrew Hessel at TEDxVilnius]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/A2h_JW7X_HE" frameborder="0" allowfullscreen></iframe>Andrew Hessel co-chairs the Bioinformatics and Biotechnology track at the Singularity University, an institution founded by futurist Ray Kurzweil and X Prize Foundation CEO Peter Diamandis, with sponsorship from world-leading organizations that include Google, Autodesk, and NASA. He is also the founder of the Pink Army Cooperative, a venture aiming to make open source personalized cancer therapies. His work has been featured in The New York Times, Futurist Magazine, H+, and Wired News.

In the spirit of ideas worth spreading, TEDx is a program of local, self-organized events that bring people together to share a TED-like experience. At a TEDx event, TEDTalks video and live speakers combine to spark deep discussion and connection in a small group. These local, self-organized events are branded TEDx, where x = independently organized TED event. The TED Conference provides general guidance for the TEDx program, but individual TEDx events are self-organized.* (*Subject to certain rules and regulations)]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35429/list-of-visualization-tools-for-genome-alignments</guid>
	<pubDate>Fri, 02 Feb 2018 13:25:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35429/list-of-visualization-tools-for-genome-alignments</link>
	<title><![CDATA[List of visualization tools for genome alignments]]></title>
	<description><![CDATA[<p><span>Genome</span><span>&nbsp;browsers are useful not only for showing final results but also for improving analysis protocols, testing data quality, and generating result drafts. Its integration in analysis pipelines allows the optimization of parameters, which leads to better results. But sometime, we need publication ready figure of genomes. Following are the list of genome alignment visualization tools, which could be useful for analysis and&nbsp;interpretation of results:</span></p><p>ABySS Explorer</p><p>Interactive Java application that uses a novel graph-based representation to display a sequence assembly and associated metadata</p><p>http://www.bcgsc.ca/platform/bioinfo/software/abyss-explorer</p><p>BamView</p><p>Genome browser and annotation tool that allows visualization of sequence features, next-generation sequencing (NGS) data and the results of analyses within the context of the sequence, and also its six-frame translation</p><p>http://www.sanger.ac.uk/resources/software/artemis/</p><p>DNannotator&nbsp;</p><p>Annotation web toolkit for regional genomic sequences</p><p>http://bioapp.psych.uic.edu/DNannotator.htm</p><p>JVM&nbsp;</p><p>Java Visual Mapping tool for NGS reads</p><p>http://www.springer.com/cda/content/document/cda_downloaddocument/9789401792448-c2.pdf?SGWID=0-0-45-1487072-p176815501</p><p>LookSeq&nbsp;</p><p>Web-based visualization of sequences derived from multiple sequencing technologies. Low- or high-depth read pileups and easy visualization of putative single nucleotide and structural variation</p><p>http://lookseq.sourceforge.net</p><p>MagicViewer&nbsp;</p><p>Visualization of short read alignment, identification of genetic variation and association with annotation information of a reference genome</p><p>http://bioinformatics.zj.cn/magicviewer/</p><p>MapView&nbsp;</p><p>Alignments of huge-scale single-end and pair-end short reads</p><p>http://omictools.com/mapview-s1367.html</p><p>MultiPipMaker</p><p>Computes alignments of similar regions in two DNA sequences. The resulting alignments are summarized with a &lsquo;percent identity plot&rsquo; (pip)</p><p>http://pipmaker.bx.psu.edu/pipmaker/</p><p>PileLineGUI&nbsp;</p><p>Handling genome position files in NGS studies</p><p>http://sing.ei.uvigo.es/pileline/pilelinegui.html</p><p>SAMtools tview&nbsp;</p><p>Simple and fast text alignment viewer; NGS compatible</p><p>http://www.htslib.org/</p><p>SEWAL</p><p>Uses a locality-sensitive hashing algorithm to enumerate all unique sequences in an entire Illumina sequencing run</p><p>http://www.sourceforge.net/projects/sewal</p><p>STAR&nbsp;</p><p>A web-based integrated solution to management and visualization of sequencing data</p><p>http://wanglab.ucsd.edu/star/browser</p><p>SVA&nbsp;</p><p>Software for annotating and visualizing sequenced human genomes</p><p>http://www.svaproject.org</p><p>Viewer (IGV)&nbsp;</p><p>Visualization of large heterogeneous datasets, providing a smooth and intuitive user experience at all levels of genome resolution</p><p>https://www.broadinstitute.org/igv/</p><p>ZOOM Lite&nbsp;</p><p>NGS data mapping and visualization software</p><p>http://bioinfor.com/zoom/lite/</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4314/postdocs-positions-in-computer-science-in-helsinki-finland</guid>
  <pubDate>Fri, 06 Sep 2013 10:11:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[PostDocs positions in computer science in HELSINKI, FINLAND]]></title>
  <description><![CDATA[
<p>Several university departments in the Helsinki region, Finland, are looking for postdoctoral researchers in the field of computer science and information technology. Jobs are available at:<br />·       Helsinki Institute for Information Technology HIIT, Aalto University and University of Helsinki, http://www.hiit.fi<br />·       Department of Computer Science, University of Helsinki, http://www.cs.helsinki.fi<br />·       Department of Information and Computer Science, Aalto University, http://ics.aalto.fi<br />·       Department of Computer Science and Engineering, Aalto University, http://cse.aalto.fi<br />·       Department of Mathematics and Statistics, University of Helsinki, http://mathstat.helsinki.fi/english/<br /> <br />Why Helsinki?<br />The collaborating Aalto University and University of Helsinki form a leading hub of computer science and modelling, including Machine learning, Data mining, Algorithms, Computational Logic, Cloud computing, Distributed computing, Human-centric ubiquitous ICT, Bioinformatics, etc.<br />Helsinki region is a safe, pleasant and attractive place to live in, with well-functioning services such as public transport etc. Finland has a comprehensive social security and health care system, including exceptionally good parental leaves, and children's day care services.<br /> <br />Positions are offered in:<br />Algorithm engineering (String Algorithms group)<br />Algorithmic bioinformatics (Genome-Scale Algorithmics group)<br />Automated reasoning and search, especially propositional logic (Computational Logic group)<br />Computational astrophysics and/or data analysis (Computational Methods and Data Analysis for Astrophysics group)<br />Computational biology and statistical methods in bioinformatics (Computational Systems Biology group)<br />Computational creativity and data mining (Discovery group)<br />Dynamic and large-scale networked systems (Data Communications Software group)<br />Intelligent multimodal information access (Content-Based Image and Information Retrieval Group)<br />Machine learning and neuroscience (Statistical Machine Learning group)<br />Machine learning for structured data (Kernel Machines, Pattern Analysis and Computational Biology group)<br />Machine learning methods for infectious disease epidemiology (Bayesian Statistics Group)<br />Probabilistic modeling and machine learning (Complex Systems Computation group)<br />Statistical machine learning (Statistical Machine Learning group)<br />Analysing ubiquitous sensor data (HIIT-Wide Focus Area)<br />Interactive visualization (HIIT-Wide Focus Area)<br />Affective computing and BCI (HIIT-Wide Focus Area)<br />Intelligent user interfaces and/or recommender systems (HIIT-Wide Focus Area)<br />Information retrieval and HCI (HIIT-Wide Focus Area)<br />Machine learning and data analysis, especially information retrieval, HCI, text and context data (HIIT-Wide Focus Area)<br />Probabilistic modeling and data analysis for bioinformatics (HIIT-Wide Focus Area)</p>

<p>More at http://www.hiit.fi/postdoc-call-2013</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</guid>
	<pubDate>Thu, 12 Apr 2018 10:00:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</link>
	<title><![CDATA[G-compass: a comparative genome browser]]></title>
	<description><![CDATA[<p><span>G-compass (</span><a href="http://www.h-invitational.jp/g-compass/" target="_top">http://www.h-invitational.jp/g-compass/</a><span>) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from&nbsp;</span><a href="http://www.h-invitational.jp/hinv/ahg-db/index.jsp" target="_top">H-InvDB</a><span>&nbsp;and its subdatabase&nbsp;</span><a href="http://www.h-invitational.jp/evola/" target="_top">Evola</a><span>, respectively. G-compass is available for free of charge. [&nbsp;</span><a href="http://www.h-invitational.jp/g-compass/cgi-bin/gc_main.cgi?species_1=Hg18&amp;species_2=pt2&amp;strand_1=%2B&amp;strand_2=%2B&amp;from_win=main&amp;gen_str=2&amp;chr_1=01&amp;chr_2=01&amp;st_1=103804298&amp;ed_1=104204297&amp;st_2=105235351&amp;ed_2=105635350" target="_top">Sample</a><span>&nbsp;]</span></p><p>Address of the bookmark: <a href="http://www.h-invitational.jp/g-compass/" rel="nofollow">http://www.h-invitational.jp/g-compass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4351/cpcri-kasaragod-bioinformatics-pa</guid>
  <pubDate>Sat, 07 Sep 2013 14:15:53 -0500</pubDate>
  <link></link>
  <title><![CDATA[CPCRI Kasaragod Bioinformatics PA]]></title>
  <description><![CDATA[
<p>CENTRAL PLANTATION CROPS RESEARCH INSTITUTE<br />(Indian Council of Agricultural Research)<br />KASARAGOD -671 124, KERALA</p>

<p>WALK-IN-INTERVIEW</p>

<p>Walk-in-test cum interview for selection to the following temporary assignments sanctioned under the DBT sponsored adhoc time bound research scheme entitled "Establishment of a Sub-DIC" will be held at CPCRl, Kudlu PO, Kasaragod District, Kerala -6711 24 on the date and time indicated against each:</p>

<p>Project Assistant</p>

<p>    Qualification: Essential: Masters Degree in Bioinformatics / B.Tech Degree in Bioinformatics</p>

<p>    Desirable: 1. Experience in the field of bioinformatics<br />    2. M.Phil / Doctoral degree in the field</p>

<p>    Date of interview 24.09.2013 at 10.00 a.m.</p>

<p>Trainee – 2 Posts</p>

<p>    Essential: Masters Degree in Bioinformatics or B.Tech Degree in Bioinformatics.</p>

<p>    Date of interview 25.09.2013 at 10.00 a.m.</p>

<p>Studentship – 2 Posts</p>

<p>    Essential Final Year/Semester students of MSc Bioinformatics or B.Tech Bioinformatics</p>

<p>    Date of Interview 25.09.2013 at 10.00 a.m.</p>

<p>The candidates fulfilling the above eligibility criteria for Item No.1 &amp; II shall apply online and walk-in for a written test and interview at CPCRI, Kasaragod on the respective dates at 10.00 a.m. The candidates for Studentship should submit the application through their Head of the Department. They shall also bring with them a set of bio data and original certificates in proof of age, educational qualifications, experience etc. Candidates who fail to produce the original of the Degree/PO certificates OR provisional certificate will not be allowed to attend the test / interview. Those who are qualified in written test will only be permitted to attend the interview.</p>

<p>No TA will be paid for the journey for attending the interview.</p>

<p>Advertisement: http://www.cpcri.gov.in/images/images/opportunity/sep4_opp.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4654/la-trobe-university-melbourne-australia</guid>
  <pubDate>Fri, 20 Sep 2013 13:05:14 -0500</pubDate>
  <link></link>
  <title><![CDATA[La Trobe University, Melbourne, Australia]]></title>
  <description><![CDATA[
<p>La Trobe University, Melbourne, Australia</p>

<p>An exciting opportunity exists for a highly motivated and enthusiastic bioinformatics researcher to work in the Exosome, Secretome and Systems Biology laboratory of Dr Suresh Mathivanan. This position is funded through the National Institutes of Health (NIH) USA, to study the role of extracellular RNA or ExRNA in intercellular communication.</p>

<p>The successful applicant will be involved in collaborative bioinformatics research with more than 30 American Universities/Institutes.  The ExRNA consortium is a multi-institute USD 17 million funded program which has 5 primary aims: to understand the biogenesis of ExRNA (vesicles and non-vesicles), to explore the use of ExRNA in biomarker research, to establish a reference profile of ExRNA in various disease conditions, to explore the role of ExRNA in therapeutic purposes and to manage the generated data through a reference portal.  The bioinformatics component is critical in managing and analysing the data generated by the entire consortium.  The researcher is required to contribute to the management and perform the analysis of ExRNA data.</p>

<p>The candidate to succeed, you will possess:</p>

<p>Experience in the analysis and modelling of data, including the capacity to integrate data from a range of sources and of uneven quality.</p>

<p>Evidence of experience in research and of the ability to work effectively under limited supervision or independently.</p>

<p>A record of contribution to publications, conference papers and/or reports, or professional or technical contributions which provide evidence of research potential.</p>

<p>Completion of a doctoral degree in bioinformatics or biostatistics with a focus on transcriptomic data will be highly regarded.</p>

<p>Preference will be given to applicants with competence in programming (JavaScript, Perl/Python), any web-based applications (PHP, ZOPE) and relational databases (MySQL).</p>

<p>Closing date:  30 September 2013</p>

<p>Position Enquiries: Dr Suresh Mathivanan (s.mathivanan@latrobe.edu.au)</p>

<p>More at http://www.mathivananlab.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4656/pandey-lab</guid>
  <pubDate>Fri, 20 Sep 2013 13:19:18 -0500</pubDate>
  <link></link>
  <title><![CDATA[Pandey Lab]]></title>
  <description><![CDATA[
<p>The Pandey Lab at Johns Hopkins University is a Systems Biology lab that combines molecular biology, analytical chemistry and computational biology with various "Omics" technologies including genomics and proteomics to understand signaling pathways and to identify therapeutic targets and biomarkers in a number of cancers.</p>

<p>More at http://pandeylab.igm.jhmi.edu/</p>

<p>http://scholar.google.com/citations?user=OhuG0FcAAAAJ&amp;hl=en</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>