<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32719?offset=1360</link>
	<atom:link href="https://bioinformaticsonline.com/related/32719?offset=1360" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35883/arcs-scaffolding-genome-drafts-with-linked-reads</guid>
	<pubDate>Tue, 06 Mar 2018 16:35:26 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35883/arcs-scaffolding-genome-drafts-with-linked-reads</link>
	<title><![CDATA[ARCS: scaffolding genome drafts with linked reads]]></title>
	<description><![CDATA[<p><span>ARCS, an application that utilizes the barcoding information contained in linked reads to further organize draft genomes into highly contiguous assemblies. We show how the contiguity of an ABySS&nbsp;</span><em>H.sapiens</em><span>genome assembly can be increased over six-fold, using moderate coverage (25-fold) Chromium data. We expect ARCS to have broad utility in harnessing the barcoding information contained in linked read data for connecting high-quality sequences in genome assembly drafts.</span></p><p>Address of the bookmark: <a href="https://github.com/bcgsc/ARCS/" rel="nofollow">https://github.com/bcgsc/ARCS/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4351/cpcri-kasaragod-bioinformatics-pa</guid>
  <pubDate>Sat, 07 Sep 2013 14:15:53 -0500</pubDate>
  <link></link>
  <title><![CDATA[CPCRI Kasaragod Bioinformatics PA]]></title>
  <description><![CDATA[
<p>CENTRAL PLANTATION CROPS RESEARCH INSTITUTE<br />(Indian Council of Agricultural Research)<br />KASARAGOD -671 124, KERALA</p>

<p>WALK-IN-INTERVIEW</p>

<p>Walk-in-test cum interview for selection to the following temporary assignments sanctioned under the DBT sponsored adhoc time bound research scheme entitled "Establishment of a Sub-DIC" will be held at CPCRl, Kudlu PO, Kasaragod District, Kerala -6711 24 on the date and time indicated against each:</p>

<p>Project Assistant</p>

<p>    Qualification: Essential: Masters Degree in Bioinformatics / B.Tech Degree in Bioinformatics</p>

<p>    Desirable: 1. Experience in the field of bioinformatics<br />    2. M.Phil / Doctoral degree in the field</p>

<p>    Date of interview 24.09.2013 at 10.00 a.m.</p>

<p>Trainee – 2 Posts</p>

<p>    Essential: Masters Degree in Bioinformatics or B.Tech Degree in Bioinformatics.</p>

<p>    Date of interview 25.09.2013 at 10.00 a.m.</p>

<p>Studentship – 2 Posts</p>

<p>    Essential Final Year/Semester students of MSc Bioinformatics or B.Tech Bioinformatics</p>

<p>    Date of Interview 25.09.2013 at 10.00 a.m.</p>

<p>The candidates fulfilling the above eligibility criteria for Item No.1 &amp; II shall apply online and walk-in for a written test and interview at CPCRI, Kasaragod on the respective dates at 10.00 a.m. The candidates for Studentship should submit the application through their Head of the Department. They shall also bring with them a set of bio data and original certificates in proof of age, educational qualifications, experience etc. Candidates who fail to produce the original of the Degree/PO certificates OR provisional certificate will not be allowed to attend the test / interview. Those who are qualified in written test will only be permitted to attend the interview.</p>

<p>No TA will be paid for the journey for attending the interview.</p>

<p>Advertisement: http://www.cpcri.gov.in/images/images/opportunity/sep4_opp.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4654/la-trobe-university-melbourne-australia</guid>
  <pubDate>Fri, 20 Sep 2013 13:05:14 -0500</pubDate>
  <link></link>
  <title><![CDATA[La Trobe University, Melbourne, Australia]]></title>
  <description><![CDATA[
<p>La Trobe University, Melbourne, Australia</p>

<p>An exciting opportunity exists for a highly motivated and enthusiastic bioinformatics researcher to work in the Exosome, Secretome and Systems Biology laboratory of Dr Suresh Mathivanan. This position is funded through the National Institutes of Health (NIH) USA, to study the role of extracellular RNA or ExRNA in intercellular communication.</p>

<p>The successful applicant will be involved in collaborative bioinformatics research with more than 30 American Universities/Institutes.  The ExRNA consortium is a multi-institute USD 17 million funded program which has 5 primary aims: to understand the biogenesis of ExRNA (vesicles and non-vesicles), to explore the use of ExRNA in biomarker research, to establish a reference profile of ExRNA in various disease conditions, to explore the role of ExRNA in therapeutic purposes and to manage the generated data through a reference portal.  The bioinformatics component is critical in managing and analysing the data generated by the entire consortium.  The researcher is required to contribute to the management and perform the analysis of ExRNA data.</p>

<p>The candidate to succeed, you will possess:</p>

<p>Experience in the analysis and modelling of data, including the capacity to integrate data from a range of sources and of uneven quality.</p>

<p>Evidence of experience in research and of the ability to work effectively under limited supervision or independently.</p>

<p>A record of contribution to publications, conference papers and/or reports, or professional or technical contributions which provide evidence of research potential.</p>

<p>Completion of a doctoral degree in bioinformatics or biostatistics with a focus on transcriptomic data will be highly regarded.</p>

<p>Preference will be given to applicants with competence in programming (JavaScript, Perl/Python), any web-based applications (PHP, ZOPE) and relational databases (MySQL).</p>

<p>Closing date:  30 September 2013</p>

<p>Position Enquiries: Dr Suresh Mathivanan (s.mathivanan@latrobe.edu.au)</p>

<p>More at http://www.mathivananlab.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4656/pandey-lab</guid>
  <pubDate>Fri, 20 Sep 2013 13:19:18 -0500</pubDate>
  <link></link>
  <title><![CDATA[Pandey Lab]]></title>
  <description><![CDATA[
<p>The Pandey Lab at Johns Hopkins University is a Systems Biology lab that combines molecular biology, analytical chemistry and computational biology with various "Omics" technologies including genomics and proteomics to understand signaling pathways and to identify therapeutic targets and biomarkers in a number of cancers.</p>

<p>More at http://pandeylab.igm.jhmi.edu/</p>

<p>http://scholar.google.com/citations?user=OhuG0FcAAAAJ&amp;hl=en</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4873/vveks-lab</guid>
  <pubDate>Thu, 26 Sep 2013 11:11:39 -0500</pubDate>
  <link></link>
  <title><![CDATA[Vvek's Lab]]></title>
  <description><![CDATA[
<p>Broad Area of Research: RNA biology (microRNA, lncRNA), Stem cells, Functional genomics, Epigenomics and Cancer</p>

<p>RNAs, especially non-coding RNAs (such as microRNA, long ncRNAs) are recently identified to be very abundant in mammalian organisms and play some key roles in gene expression regulation, gene silencing, and also implicated in disease progression, stem cell pluripotency etc. Current research activities of our lab include analysis of expression pattern of ncRNAs by microarray and next-gen sequencing data and understanding the role of miRNAs or other regulatory RNAs in various diseases, especially cancer and validation by reporter assays (renilla/luciferase) and other experimental tools.</p>

<p>More @ http://vvekslab.in/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</guid>
	<pubDate>Tue, 30 Oct 2018 10:49:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</link>
	<title><![CDATA[Synima: a Synteny imaging tool for annotated genome assemblies]]></title>
	<description><![CDATA[<p><span>Synima written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima &ndash; and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from&nbsp;</span><a href="https://github.com/rhysf/Synima" target="_blank">https://github.com/rhysf/Synima</a><span>&nbsp;under the MIT License.</span></p><p>Address of the bookmark: <a href="https://github.com/rhysf/Synima" rel="nofollow">https://github.com/rhysf/Synima</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</guid>
	<pubDate>Sat, 12 Oct 2013 18:33:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</link>
	<title><![CDATA[Showreel 2008 - Cortical Studios]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/qrReqMKe7Xg" frameborder="0" allowfullscreen></iframe>We are a bioinformatics company that combines 3D animation, multimedia and scientific knowledge to meet your communication needs. With our academic background in the fields of biotechnology and molecular cellbiology and our computer expertise we provide cutting edge 3D animation productions for even the most complex projects. We translate complex scientific information into comprehensible artistic imagery in order to improve communication in the life sciences. Please feel free to contact us with any questions regarding the possibilities for your unique project.

Cortical Studios
Keizersgracht 8
1015 CN
Amsterdam
The Netherlands
info@corticalstudios.nl
www.corticalstudios.nl]]></description>
	
</item>

</channel>
</rss>