The new features include

(i) building gene-based and supermatrix-based phylogenies using a single command,

(ii) testing and visualizing evolutionary models,

(iii) calculating distances between trees of different size or including duplications, and

(iv) providing seamless integration with the NCBI taxonomy database.

ETE is freely available at http://etetoolkit.org

Address of the bookmark: http://etetoolkit.org

Address of the bookmark: https://github.com/yjx1217/LRSDAY

Publication:

• L. Salmela, R. Walve, E. Rivals, and E. Ukkonen: Accurate selfcorrection of errors in long reads using de Bruijn graphs. Accepted to RECOMB-Seq 2016.

Download:

• LoRMA 0.3 source files
• README

Address of the bookmark: https://www.cs.helsinki.fi/u/lmsalmel/LoRMA/

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

Karnal -132001 (Haryana)

A walk-in-Interview is proposed to be held at National Bureau of Animal Genetic Resources, Karnal (Haryana)-132001 at 10:30 AM on 05.09.2016 for the selection of Three Research Associate & One Young Professional - II as per details given below:

Name of the Scheme / Project: Center for Agricultural Bioinformatics. The post duration is Upto 31.032017 or earlier & Co-terminus with the project.

Research Associate (Three posts)

Date & Time of Interview: 10.30 A.M. on 05.09.2016

Essential Qualifications: PhD degree in any one of discipline/Subject Biotechnology/ Animal Genetics and Breeding/ Biochemistry/ Bioinformatics/Molecular Genetics OR Master’s degree in any one of above mentioned discipline/Subject with 4 years/5 years of Bachelor’s degree having 1st division or 60% marks or equivalent overall grade point average, with at least two years of research experience as evidenced from Fellowship/Associateship

Desirable Qualifications: Experience in Database/Next Generation Sequencing Data analysis for 02 RA posts or working experience in molecular biology, gene expression data analysis, SNP genotyping and sequence data analysis, functional gene characterization for 01 RA post.

Young Professionals II One position

Date & Time of Interview: 10.30 A.M. on 05.09.2016

Essential: B. Tech or M.Tech. in Bioinformatics / Computer Science / Computer Application.

Desirable: Experience in Linux, MySQL, Java, C++/ PHP/ PERL R based data analysis and application development in Bioinformatics.

More Info : http://14.139.252.116/ADvertisementforCabinScheme.pdf

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

Title of Project : 1. “Analysis Of The Structures Of Known Antimicrobial Peptides Using Machine Learning Algoitms And Molecular Dynamics Simulations”

Senior Research Fellow /1 Post

Qualification: First class M.Sc. in Bioinformatics/ Biological Sciences from recognized university with 2 years research experience and CSIR/UGC/ICMR net qualified OR First class M.Sc. in Bioinformatics/ Biological Sciences from recognized university with 2 years research experience Research experience in bioinformatics and wetlab methods.

Age: Not exceeding 35 Years

Pay Scale : Rs.18,000/- + 30% HRA Rs.14,000/- + 30% HRA

Project Assistant (Level-II) /1 Post

Qualification: First class M.Sc. in Bioinformatics/ Biological Sciences/Computer Sciences Training experience in bioinformatics and wetlab methods .

Age: Not exceeding 28 Years

Pay Scale : Rs.8,000
How to apply
Candidates must bring along with them all the relevant documents in original and one set of attested photocopies of the same and one passport size recent colour photograph.

Walk-in-Interview on 28.06.2016 between 09:00 hrs. to 12:00 hrs.

More at http://www.nirrh.res.in/links/job_oppotunities.htm

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Address of the bookmark: http://biobits.org/samtools_primer.html